Description :
From Genome Similarity Track
Location :
Scaffold_38:60539- 62326
Transcript NameFunction/comments
Hyaar_Emoy2805344unnamed protein product
Hyaar_Emoy2805345metalloprotease family M20D, putative

Sequence
1787 bases(100 bases per row)
CAGTAGCTTCGACAGTGAGTGCACCGTACGACCATACTTGAGGTCACCAACCATCGTAACAACCTTGCCCTTTAGATTATCCAGGTCACCAACCTCGCTG
TAAATTGTGTACAGATCCAGCATAGCCTGCGTCGGGTGTTCACCCACACCGTCACCAGCGTTCAGCACAGGCTTCTTCGTAGCTTCAGCAGCTATCAAAG
CACTGCCTTTAACCGGGTGGCGAAGTACGATCACGTCGGCGTAGCACTCAAGGCACCGGATTGTATCATAAAGTGTCTCTCCTTTCTTACTGCTGGACGA
GCTCTCATTGACACACACCACAAGGCCACCGAGACGCTTCATCGCAGCTTGAAATGAGCTGCTCGTGCGTGTAGACGGCTCCATGAACACGTTGGCCAAC
AGCTAGCAACAGCATCAAAAAGCAACGCAGGTCAGCTACAAAGATCCATCGTAGTTCAGTACATTGCAAGGCACACCTTTCCCTTAAGCAGGTCATTTGC
ACCCTGCGTCTGGACCATCTGCTTCATCTCATCAGCCACGCAAAGCACACGTCTACAGCACCAATTTAAGTAACCCCCCCCTCTATCTTCCAACAATAGC
GAGCATCTCACTTACTGGGCGCTCTCCTTGCCAAACTGTGCAATCGACAAAATGTTCTCGCCGTCCCACGAGCCCACAGTCGCCTTGCCGTCGAGCACGT
GCGCCATAGCAGAGTGAAAGTCTGACGTTGCATCGCCACTGGTTGGGACAAACTGGCCAGTTTTTGCTTGGCTTGAATCGGACGCATATTTCAGCGAATC
AGAACGGATGGTGCCTAGCATGTTTATGCGAACCTAGTAATGCTCCTTCAGCCACTCTATTTCGTTAAGGCACCGCATTACCGTTCCCCTCCGCTCAATT
ACGACACCGTAAACGTCTGCGTACTTAGTCATTCTTCGAGTCAAAAACAAAACGTGATGGGTGACCCCCATGAGCAGGATCCGGAGCTGTATACCCAGCA
GCAGGAGGCCCACGAGCACGCCCACGCGAACGGCAGCGAGACCAAAAAGGCTAAAAAGGGCTCTGGCAAGCGATTGAACGACCGCGAGCGCGTGGATATC
ATTCAAATGGCCGAGAACAGCAAAATCTCCAAGCGCCAATTGGCCGATAAGTTCGGCGTGAGCGAGGCGGCTATTCGCAAGCTGCTGCTCAAGAAAGACG
ACTTCTTACGACGTTACTATGACACACCCGAGGACATTCGTGATCAGCGGTTGCGTGGCAAGAGCACGCGCGTTCGGGCGAACACCTCGGACAGCTGCGA
AGGTGCTGGTGGATCCATACAACGCTCATGTGAATCGACGCCGGTTAGTCAGTCGCCATCTACTATGCACGCTTCTAGTATGGGTGTGTACCCACCTGAC
GATCCATGGAAGTATGGGCTGCATGCAATGTTAACCAAGGTCATGCCATTTTTAAAGAACTTTACCCAGAGCAGAAGAGAGCCGCACACGGCGTTGGAAG
CGTCGATTACTGCTACGGATCAGGATGTTAAGGCTTCATCAGTGACGGTGGAAGAAGTGGCAAGTGTGGAGAAAAGGGACTGGATTAGCTTTTCGCGCAT
GCTGCGCGATATCCGACGCGCGCTCCATCGATATCCCGAGACGGGATATCAGGAAGTACGCACACAGGCTTTTATCAGAGGATTCTGTGAAAAGGCGTTG
CAGATTCCGAGTAAGAACATCCGAGAGATGGCGTCTACAGGACTTGTGGTGGACGTGTGCTACGAAAACGCGACCGTTTCAGCATCG