Description :
From Genome Similarity Track
Location :
Scaffold_28:605249- 607139
Sequence
1890 bases(100 bases per row)
TGGTAGCTTGACTAGACTAGAATATACCAATTGTGACTAGGCCCATTTTTTTCGCAGTCTTACGACATACGGAAATCGTGATTTTTTTATTCGAAGTAAT
TCATTAGATTTTGGCTACTTCCGGTCGAAAACAAATATTTTGTCGCAGGTCACCCATACACACGAGCTAGCACGGATCACGGCCGATAGCGGCGCTGAAA
ACGAGCGATGACCCAGGAGGCGGAGGCGGATATCATCGCCGAACCGAAACACGCGTTCAATGAAGGTAAGGGATTCGACTTGATCTTCTCCAAGTCTTCG
GCGGCTCCAAAAATGCACGAGCATGATGAGAAGTCCTTCAGGTCGCAGAGCACTGTCACTCTGTCAGGTGCGCAACTAACGTTCGCCACTTCGCCAGTTT
TGTTTTGGCGGAGATCGACAACTACGTATTCTGTCACCTCAAGTGCAGCATATCGACCACCAGGAACAAACTGAGGCTCATGACCACTGTTTTTGCTGCC
ATTCACATGCACTAAAATCCCCACTGAGATAAAAGACAAAGGTATCTTCGTCACTTTCCGACCGAGTTGACGGAGGGAACACATGAGGTAGCTCGGGGCA
AACTAAACAATTACGCCGCGTGAATCGAACGAAACCTTCCAGGAGCAGACGCTGAAATGTTCTTGCCGTGGGGAATTTCAGCTCGGACGCCGACATGTTG
CCAATGACGCTTCTGATGAGACCATGGAGAGATGAAGGATCACGGTAGCTTCGATCCCAAAACTGCCATCGGTAGTAGAATCTACCAGCCAGTGGAGAGG
TGAATTCTTCTTTTTCGTCTCGGTCTTCAACGATGATCCCAGAAGTCTTTAAATCGATAATACAATCGCGCTCTTCATCATTCCACTCCACATGTTGACG
GTCGGCATCGTTCAGCAAACACTGAACCAGGAAGGTTGAAAGTCTCGGGCTTGGAATAGTGTGCTGAGCTCCAAAACAGCGAAGCAAATGGGACATCATC
GTCTCCGAAAAGCAGTGCTGGAGTAGATCTGCCTCCGTGTAGGAGCGCTTCCGGAAATCCATCGCGATGACGTCAATAAGATCCCGCAGGAGAATCATGT
GTTCGTTGCTTTCTCGCAGGATAATTTCTTCCAGTATGGATATCGCATTTTAGGTGGTAGCCCATTTTCGAGGGCGAACAGTTCACGCGCTTCTTCATCA
CCCACTCGAAGGTCTTCTCTCGTGAGCTTGCTCGGAAACTCTCCAAACACTACGGGGCTATCGGGTGATTCAACCTCCAACGCGTGAGTAGCCGAAATAA
CAAACCACACATTACTCGGGATCCAGACGGCGGTATCCTTGAACAGAGATCGGCAAAACTCCAAATCGTGGTGTACAGGAAGTGGGCATCGTCCAGCAAA
AACACAAATTGCTCATCAGCGGATGGATCATCGATATCACCCGGTCGGCGGAACTTGTGCTGAATGACTGGCAGATTACACTCGCGTTCGAGAACGTCGA
CTCCGTATTCAACGAGCACGTCCTTGGTGTAAGTAGCGTGCACTGCCACCGGCATGAATGAGATCTCGGTCCTGCGAATTTCCGGATAGCGGTCCTGGAA
CAGGATCAGCAGCGACGTCTTCCCGGAGCCTGAGGGACTCAAGATGAAGGAAAACGGGTCGCTTTGGACCGCGTTGTAGAGCCACTCGACGAGTCGGATA
CGTGGCAGACGAGGGGAATGCGGAGCGAGCCCCATAGGATATGGACGCACTACGACCTTCTCGGCGGATGGGTCTTCTGGAAGTAGCGGCCGCCATGGAA
TCATGACCAACAGGTGAATATAACGCGGAAACGGCGGGAAGGGCAACTGCAGCTCTTTCAACCATTCCTCGAATGTTGAGGTCGAATTCA