Description :
From Genome Similarity Track
Location :
Scaffold_106:6052- 10951
Transcript NameFunction/comments
Hyaar_Emoy2809631omega-3 fatty acid desaturase
Hyaar_Emoy2809632AlNc14C364G11036

Sequence
4899 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCATAGATAGACGCATGCTTTTCACGACTGTTATGC
GATACACTCCAGTCCACGACTGACTGGTGGACGGACGTCATCAACCACATGACATCATCTGCGCCAGTCCTGCTCGACATTTCACCATCCACGTCACATT
TGCTCGTTTATTTTGTTTCAATGCCTTGTCTCGCTCTGACTATACCGAATCTGTCCCCGCCCAGTCAGTAGTGATCTTGTCGCCACGCGTCCCGCACCAA
GTCTCACGTAACACCATTTCGGAACTTGCTCCGTCAGCCACAAAAACGTCCATGGCGACCAAGCAATCGGTCGCGTTCCCGACCCTCACGGACCTCAAGC
GGTCGCTCCCAAGCGAGTGCTTCGAATCCTCATTGCCGCTGTCACTCTACTACACGCTGCGCTCGCTCGTGTTTGCCGGTTCCTTGGCTGTAAGTCTCAG
CTACGCGCTCGCCCAGCCACTCGTCCAGAACTTCTACCCGCTCCGTGTCGCTCTAATCGCGGGCTACACCGTGTTCCAGGGCGTGATCTTCTGGGGCTTT
TTCACCATCGGTCATGATGCCGGTCACGGCGCTTTCAGCCGCTACCCGGTGCTCAACTTCACCGTCGGGACGCTCATGCACTCGCTCATCCTCACGCCGT
TCGAGTCGTGGAAACTCACGCACCGCCACCACCACAAGAACACGGGCAACATCGACCGAGACGAGATCTTTTACCCCCAACGGGAGAGCGACGACCACCC
AGTTTCTCGCCATTTGACCTTCACGCTCGGAGCTGCGTGGTTCGCCTACCTCGTCGAGGGGTTTCCACCTCGGAAACTCAATCACTATAACCCGTTCGAG
CCGCTCTTTGAACGGAGAGTATCTGCTGTTATCATCTCAATTCTCGCCCAGTTTTTCGTCGCGGGACTCTCGATCTACCTCTGCTTTCAAGTGGGAGTCC
AGGCTGTGGCGCTCTATTACTACGGACCGATCTTTGTCTTTGGCACGATGCTCGTCATCACGACGTTTTTGCACCACAATGACGAGGAGACGCCGTGGTA
TGGAGACGAGGACTGGTCGTACGTCAAGGGCAACCTCTCGTCGGTTGATCGGTCATACGGACCGCTCATTGATAACTTGAGCCACAACATTGGCACGCAC
CAGGTCCATCACCTGTTCCCCATTATTCCCCACTACAAGCTCAAGCCCGCGACAGCTGCTTTTCGTCGTGCTTTTCCTCACCTCGTACGCAAGAGTGACG
AGCGGATTCTTCAGGCGTTTTACCGCATCGGTCGGCTCTATGCAAAGTACGGCGTCGCCGACTCGTCAGCCAAGCTGTTTACACTCAAGGAAGCCCAATT
GACGTCGAAAGCAGCAAGTGATGCCAAAGCAGCTTAGGATTAGCGCTGGAAGCAGTTCTCACTCATGCAAGACAGGCTCACAAAAACGAACGATGGACGG
ATGGATGTGGCAAGTGATCTATTGACAGATGAACGGTCTACGTCACTTCTACTCTAGTCTAACGAATGGGCACGCGGTTTCGTGGTTTGTCTAGAAAACG
CCCAACGAGCAGGTGCTAGTTTGTTACAATGTCTCGATTACTTACCGTGACAGTCGTCTCTCTCTATATTTTCCATCGTTAGTCGTTACTGATACCTTGT
CGAAGTAATGCTTGGTGGGCTGGTAGTCGACTGGTATTCGCCCACCCGTTTTATAGCTGCAACCACATACCGGCAGTACCTCTTTTTATCGGTCTAAATG
CTGTCTTTACATTGGGCTTAGCAAAGCACACACGCAAAACAACACGGCAACATCTAATCAACATAATTAGCACGAAGATGCTAGAACCCGCAGAGCTAGC
TCGCGTATAGTTTACTATGACGACAGTGCGTGGATAATGGTCGTGCAACCCAAAATGTGGAAGAGCAGAGAGCTACGATCCACATGTACTACTAATTCTC
CCCGCTTTTCCTGACACCTCACCGACACGCAGCACCCTTTCGCGTCCGCTCTCTCTCTCTCTCGTCTCCCTTGTACCCCGTACCAGGTATTTCTATTTGC
AGCCCACGCTTGCCCATCTTCAAAAAGTTTGCACAGTCACTGTAGTCTCCTCAGTCTGCTTGGAGAATCCCTCTTCTTTTCCCGTCTTGCCATAAACTTA
AAGCAGCAGCACGTTTTCCTTAGGAGTCATACCGCCACCACCACCACCGCCGCCGTTATTATAGGCCTCTGCAGCCGCCTCTGGAGTTGCCAATTCGGCC
TCCTTGCCCTTTTTCAGCAGCCGCGCGCCAGCAGCTATAGCTACCACTGCCAAGCAGCCAACGACGATAGCAATAATGGACCCAAGGCCAAGGCCATCGT
CTGAAGAAGTCTTTGCTGTCTTGGAACTGTCGCTAAGAATAGACCCGGGATTGAACTCAGCCTGTTGATTTGCAGAGCTACTGCCGGGGGAAATCGTAAC
GCTACCAGAGCCCGACTCAGACGACCACGAAAGGGACGTGCTATTCGACGAATCGTCGTCGTCCGCTGTTGAATTGCTGCTGCCCGAAGCAGAGTCATTA
GCATCACTTTTGTCACCTGAACAAATAATAGGAATACATATAACATTACAACCACGAAGATGCAAAACAAAGACAGACAGCGTCAGTGCTATTCCAGCAA
CCAAATAACGTCCCCCACTAGCACTAATAACAATAACACTAGCACAAAAAGCGTACCGTTTGAGCTGCTGGACGTCGAGTGCGACCCTGAACTTGCGTTA
CTGTCGCTCGTGCTGTCCATCGAGGAATGCGAACCACTTGACGAGCTGCTGCCACTTTTGCTGCCACTGTTTCCCATCTTGCTATTGCTGCTACTTGGTG
CCAGCGTCACGTCCACTGCAATGGTACCTGAAAGTGTCACTGACCTACCGCCTTTTGTCAACGTGCCGTCTCCATTCACGTAAATGAGGTCTGGACGACC
TGCAGCGGCACAGCCCATAATAGGCGTCAGCGGCAGAAGCGCACAGCTCGAGCCCGTGGGACATGCCCCGACGCCTTGAGTCAATCCCGTGGCGTAGTAC
GTCCCTGAACAAGGCAGAGCCGTCGTGCACTGCACGCCCGGGACGTCCAAGACGCTGACTGTATAGGGGCAGTCTGTACAATAAATCAATCCATTATTGT
CAAAACGTGTTGGTCAGTGGCCAGTCCAATGAGGTCACGTTTTGTCATATATACACAACGACGTACCCTGAGCTGCCCCGCGCTCTATTAAGAGCACACA
AAGTGCGGTTGCGAACTTAAGCGCCATCCCCACCACCACGCGCGACTTGAGCCGTTCGATTCTTCTTCACTTCACGTCACTTCCGCGCGTCGCGTCCGTC
GTGACCGCGTCTGGTCCGATTAGTCGCTTTGTGTCGTGTCTCTTTTTTATTTCTCCTTCTCCTCCTTTTCCTTTTTGTCTCAGTCGCTTGACTACTTTTT
GGAGCTGAACTTTGAGAGAGTGAGAGAGCGGTGCAGAGGGTACCGAGGAAACCACTTTTTGGAGGTCGAGCTCCAGTCGGTGAGAGCGTTTTCCGAGGAA
AAGCTGGAAGTGAATGAACGCGCGACTTGCAACAGCAGGCGAGAGAGAGAGAGAGTCAGCCATCGAGCGATCGTCCTGTTGCCTGTCGCGAGGCGACGCT
CTGGCCATGCGATTGGTTGAAACGGTGAACCCCTGGTTTCGATGGTAGAAGGCGGCCATTAAACAGCTGGTGGGCCACTGCAAGAAAGGGCGCGCGGCCG
CCCGTTTTCTGTGTGCAACGTGCTGCTTGTGTCGTCTCGCCTTTCTGCAACTTCTGCGACTGCTTGACATGCTAATGGGACAAGTGCACTAAGTACTGTA
ATAGAGACAAGGACTTTGTATCGTAGACAGACAATACACACAAGTGCGCGAGTGCGACATGAAGTGTGGTGAAGTCTAGTGGAGGTGCTGAAGTGTAGTG
GAGGTGCTGAAGTGTAGTGGAGGTGCTGAAGTGTAGTGGGGTGCTGAAGTAAGCAAGTGCTCAGTTGATTACCAGTAGCGACTGGAGGTTCTAAGTAGAT
CACTGGGTTAACTGGCGCATGTAGTTGGTTTGGGACCATGTGGTGGCTGATTCATTGCGTTCATAGAGGGATGATGCCATTGAGCTATTTTACAACTCAC
TTGAGGCGGCCACAAAGCATTCATAGCAGCGAAAAGTTTGACATGTGTTCTTCGGTCCCGCTGCTTTGGTTGAACAAACGCAGTAGGTATACGACGTATG
CAAAGGTGTAATTGATCGACGGTACTCATGTACTATCAACAACTTTCGCGACGCGTTACGTCAGTTGCGGGAAGCGGAACGGAGGACTCATTTATTAAGT
TAACGCTTTGTTGCTGCGACACCTTATTGCCGTTTATGGAGAGAAACTGCCTCGTACTCGACGACTTTTAAGACGAGCGGTACGGCAGGACGTGCTTCTT
AAAACATACTTGACCCAGGAAGATGCTTGAGATGTGAGGACACCTAGAGATGTGGTACTTCTCTATTCGTCACTGAAAACGTACATGCATACATGACGT