Description :
From Genome Similarity Track
Location :
Scaffold_844:6052- 7757
Transcript NameFunction/comments
Phypl_g11261hypothetical protein

Sequence
1705 bases(100 bases per row)
GACCTTATTGAGGGCCCTTCTGGTGGCGAATATCATTAGACACTCGACGTCGCCCTGGGCATCGCCGATCGGGATCATTATCAAAAAGAACGAGATGGAT
ATAAGGCTGTGCAATGATTATCGACTCGTGAACGGACTTACACGGCTGATAGTTTATCTGATGCCGTTGATCAACGATCTGTTGGAGGACCTGGTCAAGG
TCTTATGGTACTGCTCGTTGGATATGGCTAGTGGTTTCTGGGTGGTTACGATGACGGACCGAACTCAAGCGATCTCAGCTTTCATCAATCCCTTCGGGCT
GTTCGAGTGGAACCGAATGCCGTTCGGTCTCAAGAATGCACCACAGATCTACCAGCGACTGGTGGACAATGCGTTGTACGGGTTTATGAAGATCTCCCGA
TCGGGCGATCGTGGACAACTTATTGACTTGTTTGAAGCGGGCGAACCCGCTGACCCGGGTAAACCGTTGGTGCTGGGACGCCAATCGTACATTGATGACA
TCCTAGTGACTGCCGGATCGTGGAATCAGCTATGTGATCGAGTGGAAGATCTATTCGACGTATGTGACGAGTGGAATCTGTCTATCAGTGTGGTGAAGAG
CTTTTGGGGGCTGAACAAAGTGGATAATCTGGGACACCAAGTGTCGCCTGGGGGATTGGAAGCCCACCCAAAAGACCTGAAAGCACTAACCGATCTACAT
CTCCCGGAGTCTCTCCGATCGATGCAGTCGTTCTTGAGCAGTCAGTACTACTATAGCCGCTTCATCGAGGACGATGCGATCTATGTTGCGGTCCTGTACG
AGCTACATGAGGTGGGCTTCGCTGAACTGCGAAAGCAGCGAGATCTCCGTCAGTTGCTGGATCGATCGTAGCTTGATCATGATCCCACGAGTCCCGATGC
CGGGACGCTTAACACGACCGGGTCGGTCCCCGTAATACCGGGGTCGAAGGCCGCGGGTGAGAGATGGATTCGACCGCAAGAGGCCTTTgagacgctgaag
acgaagataTCCACGACGCCGATTCTACGTCACTTCGACCCCGATCGCCATGCAGTGATGACCGTGTATGCCAGTGAGTGGGCGGTCTCGGCGGCTTTAG
TGCAGGATCGCGAACAAGTATATCACCCCGTGGTGTTCGCAAGCAGAAGTCGAATGAGTTGAATTATAACGTGGTAGAGAAGGAAGTATAATTAACTACA
GCATGCTGGTGGGGCGTCAGATCCGGATCTTGACTAGGCATTCCACGTTGGCATAGCTCTTCAGACCGCCGAAGCTTCAGGGACGACTTGGACAGTGGGC
TGCTCTCCTATCACGTGGACACTCGAGATCGTGAAGTGCGTGAACGGGGAAGACGAGATCCTAGGGGCGATCACAGCGAGTATCACGCCCCGAtccaagg
tggacgaggcgctgacTACGATCGCACCCAAAAAGGAGCCACGACGTAAGACCCAAGCACCGATCCCGACCGTGAGGACGGGCGAGGACCTGTTCGTGGT
GAGTTTTGATGGATCTGCCCGTGATAagcgtggcggcggtgccTACAGCGCGATCTTGTGGTAGTTGCCCGAGTGGACTGTCTTGAAGGCCCGATCGAGC
TATGCTGAAGGACTGACTGTGAATGAAGTGGAGTACAACGGTCTCCTGCTATGTTTTGACCTGTTGGATACGATGGACCAAGGCCGCCTGGTAATCTGTG
GCGGT