Description :
From Genome Similarity Track
Location :
Scaffold_26:605182- 606434
Transcript NameFunction/comments
Phyca_LT1534507281signal peptide peptidaselike putative
Phyca_LT1534507282Hypothetical protein
Phyca_LT1534114308conserved unknown protein

Sequence
1252 bases(100 bases per row)
cagcagcttgagcttgaagcgctttagccacaaaggaacaattacctcggtctacgaccaccaaagcgccatgtactgacacaacagcgtcaggttgaag
atggtatgacgcacagccgtcacggttccaagcgggtaattgtaccagcgtcttccagcgggagtcgaagcgcgcaggcaaagcgacgccccatccagca
gcggcactgggcgaacacaattgatccgagaaggcaggagcttcatgacgggactgaggtagaaggtccagcgataggatgcctgtagggagcacagcgt
ggacgcaaggaagcagcagcagcagagcgagcagcatggccgaagagatactacgctttgatatctggtgttctaaatttagttgggatgaaaaaaaaag
tatggactatttttagaacagacttgttgaagaggactattaaagaaaaagacttgataaaaagaatgaagaagagacaaatgctaagtaccagtatatc
tgctgaagcattgtctgtgtttgatgagcgacagatacagcgacgtccagtccagtttgaaattacggacattttagatcagaaaccgttgtcttcttcg
ccgttaggacctttgtcactccctcgaccaagcaggaaggtcgggtttaatcctccagcagctcctaaatcgaccaagaaagaccggttatcgctgcaaa
atggtacttcatctagagaatacgcagagcggttggagcaggctgagaatacggagttattcagctatgctagtactttatgtcatcgagttacggggaa
atatctaccaaaaagtgtgctacaaagcgacccagaagcgcaacagcgagagcttgagcgaattcaaagcgacccggaacttctacgagctatcgactct
gtgcgtctattgtctgctcagtttaaggatgtggcacagactacaatgggccatcgaaaagaactgggacatacgctgtttcgtattgaagagagttatc
tcaagctgtttgagaagttgctggagctttctctacggttgtactgggaatatgagaaccggactgaagcacagcgaagagaagaccagaagagtattga
acactggcgggaacagtatgaacggaaatgtgtggagaacgtaaaactcaacaagaagatgacggcgagggacattatccatcgcacaagagaaattgag
ctcaaagattatcaagaacagatgaaggagatggagaaggaactgggaagtc