Description :
From Genome Similarity Track
Location :
Scaffold_1782:605- 2690
Sequence
2085 bases(100 bases per row)
ATACAAGGACGGCTGTGTGTCGCCGTCTTCGAGAAGGAATCTCTGCTAGAACGCTAGTGGTTACGCCGGTCGTAACGACACGAGCCGTCGTGCAAATTAT
CGATGCTGTTGGAATCGTGCCAGTTTATGATGAACACGGGTTGGAAGTCGGCAGTAGCCTTGAGCTACTATCTCATAGTCTTGTGATTGATTGTTTTCTT
TGCTAAGGCTTACTTTTGGCATCACCAGCTACACTTCCAACTCCTTCACATTATAAATACTGCAGAAAACTCCCACAAAGCTACATGCCTCCCTCATCTC
CTCTTGGAAATGTCAAACCTGGCTACGACTGCCATTCACTTGTGTTATACAACCGCAAACCGCCACAGCAGCGGACATGCGTCAAATTTACTATTTTAAC
ATTTCGGACATCCAGAATTCATATTTTGTCAAAAACGGTTGTCTGCTTTAAATCGGTAATTATTGCTACTTCCGAAACTATGAATGTAAACCGGCAGAAA
GCAAATATCTGACGTTAAATGATTTTAAAAATGTCGATTATTTTTTTTCTGTCTAGCTACGGCGCGGTGCAACGTGAATTCTTGCATTCGTCTGTCTTGA
ATGCATTTTTTTCCCGCATGTGTGCAAATATTAGCCCTGGTACTAGTTCATCGACTTGGAAATATTATATGTCGTCATGAACGAACACCAAGCCCCACGC
ATACACATCGTTGTGCTGCGAGAGACGAACACCGCCAACAGTACCAACGTGTTCTTCTCGAATAGTTGCAGCATGACCTTCTTTTCTTCCGTGGAACTCC
TTCAAAAAGGCCCACTTAAGTGGAGCGTAAGATTGTGCTGTCAACACTTGCTCAAGCCGACCAAGATTCCAAAAGTCCCTGGGAAATGGATTTTGACGCA
GTGCACCTCTGGTTGCTCGAGGTCGCCCTGGGGGTCGTGTGACAGGGATAGTCTCTCCAGCTCGTACTAGATCTACTTTTCCCAGGAGATGAAGGGATGC
AATAACTCGAAAGCAGATCCATCCGGATTGCATAAAGTCCTAAACGATGCACTTGAGAGCGTTACATATCAAAACAATCCGTAGCATGACATTAAATACT
GTTAGTCGACGGATACTTACTACCCGGACAAACAGTTAGCTGACACGATGGGGCTCTGGATTTTTGAATTATGAGAGAGCATGGTTAGCCGTGGATAGGC
TCGGCATTCCCAGACACGAAAGTCTCGAGACGAGTaagtctggatgaagctgagttCCTGACGACAGGTAAGAGGCTACAGGAGTGTAAAATGCTCCTGG
TAATTATATACCAGAGCCACCTGTCCTGATACGGCGCGGAGTATATATAAACGCGACCAAGAACACCAAGCACCCAGAAGAAGTAACCAAGTGTGAAGAT
ATCCCGGACACAAGTCCTGGATGGACACATCGGGAAGTATACCCCGGACGAGTGATCCCAATCGGATCACCCGGAAGTGGATATCCCCGTATACAAAGAC
CAAGTGAATAACGACCGACCAACTCGACCGACCGATATATGTCAAGATCCATGAGaccttgaagaacagcaatgaacCCACCGACTCCAAATCGCAAGAA
GCAGGCAATGACCAAGTCAAGAGACGATTACGTTGACGCCACTATATTGAAAGTAAGTCCAAACCATACGTGCATGTCtatagcagcagaagataACAGa
caaacagagttcgttttaccgATAAACCCACAAGTCGCCCGGAGAAACCTGCCGGACGTGCATTCCCGGAGGACTGGGCAGAAGACAAGTGAGGCGAAGG
CACGCCGGAAGCAGGACTACCGGCGCGGAGCGCTATACAAgaatcaagtccaagttagGGAGATGACCAGACGGGCATGTCTAGGGTTGATCTTTTCAAT
TCCATATCCTAGTTACAGTACTTATCCCATAAGGTGATCCtgtatttcatattaacTGACTACCTTGTGGGTTGGTATGAATAGTCCCAACCTAAAAGCT
GAACGGAAGTACTATCGAGTGATTAGGGGTGTATTAGTTCACTTTGTtgagggtggtgcgcgtgtAAACGGCCATCCAGGATTGA