Description :
From Genome Similarity Track
Location :
Scaffold_2490:605- 2184
Transcript NameFunction/comments
Phypl_g15132hypothetical protein PITG_18738
Phypl_g15133hypothetical protein PHYSODRAFT_347717

Sequence
1579 bases(100 bases per row)
CGAAGGAGAGCGCTGGGCAGTTCTCCAATCGTATCAAGAGCTCGAAAAGATTCTTTACCTCCTGCGTGTGCTGATGCACCAGCGTCCGGAATACGTGGAG
TCCTCCGTTGGGTACGTTTGCAATGCGATTGGTTGTGTTACTTACTATTTAGGCGATGGGATGGGTCATGTCTAAATGTGTGCGGTTTTCCTTGTCAGTA
CTATCGAGACGTTGCTCGCACTCTTCCCGTCATCAAAGCGACCGACATTTGTGTAtccgtccagcaccgcaaCACCAGAATCTAACTCCATCCCTGCGCG
CGAAGCTCTTGTCGACGAGTTTAGCGACGATTGAGGCGACGCACGCTTCGGGATCCGCTGGCATTGAACTGTAGCTGTCGTTGTCACGAACCAATGCCGA
GATGGCCATTACAGAATGCGATAGTGCTGCCCACCTGAATACATCAGCAATACCATTTTGGACGAGTTCCATCGCTTGGctagctacatgtagctagCTG
CCTGCACGGGGCATTCTGGTTCACAGGAACTTCAAACTCGTGAACTGTAGGAGTGTGTCGATTGACTTGGTGGACTCAATATTTTAAAAGTTACTGCGTA
GTATCACGATCCCAGTAAGACTACACACGACGATGGATGCTACAATGCTACAGCACGCTTACGCGCCATGCACGGCGGTGTAGTTGTAGTACACCAGGTT
CTCGTACTCGCTGTCGCAGTACGGGAACTCCGCGTCCGAGTCCGTCGGCGCgaacagcgtcttgccgGACGTGTACGTCACGTAGCAGCCCAGGAAGCCG
CACACGATCAAGACGATCAGCGCCGGGATCTTCTCGTACAGAGGGATCTCGCGccagagcttcttgagcaggaAGATAATGGGCAGCAGGATACTGATCA
GCGTGATGCACGAGGCGCCCACGAAGTCCACCAGGTCGGAGAAGTGGTCCTTGAGGATAATCGAGAGgatgaccagcaccacgatgATGACGATACGGAG
GATCACGTACTTGATCGCGTTCACTCCTCGGTACTCggcagcctccgcctcgagGTCGCCGTAGTACGGgttctcggcgtcggcgttcGAGATGTACGAC
CTCTTGGACGAGCGACGGTCGTCACCGTTGACGGCGTCCTTGCTGGGCGTGTTCGCAGCAGCGTATGAAGCGGCCGCGTACGTGAGGGcgttctccacgt
cgtcctccttcttctggtgCATCTTGAGCACCAGGCGCtcggcgaggaagaaggccgGGTTCAGGATGACCGAGAAGGCGATCGTGATGTGCAACTGCAT
GAAGAAGTAggccatgacgacggcgccccAGTCCGACTTGAAGCCCAGCGTGGTGAGGCCGCTCGTCGAGTCCGGGTAGATGGAGTAGAGCAGGTTGCCC
GTGATCTGGCAGCCCACGGCCGAGtacgccgtgctggccaggACCAGGAACAGGCACGAGATAAAGGCCATGGTGACGAACACCACGCGGGGCATGCGCG
TCGGCTCgctgtgctggcgctgcagggccgGGATCACAATGCCGGCGTTGTAGGCCAGCGACAGGTTGCCGAACATGCC