Description :
From Genome Similarity Track
Location :
Scaffold_807:6049- 14519
Transcript NameFunction/comments
Phyag_g8143hypothetical protein PHYSODRAFT_343916
Phyag_g8144hypothetical protein PHYSODRAFT_476538
Phyag_g8145hypothetical protein PHYSODRAFT_552380

Sequence
8470 bases(100 bases per row)
CGGGGGCATTCTGGCCTCTTTCTCCATTGCGCTATGCGGCATGTTTGAGCGTTTACCACCCGACTCGATCGCTGAGCCTCAGCTTCGCGAGGTTATGGAT
GCTGTCCTTGCTATCCTTGACCACCCTTTTGCTCTCGGGGACTTGACTCGAGCACGCAACGCCGTGGGTTTTGTGTTGCACTATGGGCTTAATGGATGTT
TGACAGAGCGTCAGCAGGAGGTACTTCTGGGTGCGTATTTACAAAGGTTAAAAGAGGAAGCTCAGGCATCAGACCCAAACCATCACAAGATATTGTCAGC
TCTAGTGGAAATGAGCCATATGTTCCACTCGATGGGCGAGGCTTCTGTTACTCATGCGCGCGAAGCCAGCGAGATACTCCAAGGCCTGATATGTCACGAA
AAACAAAGTGTTCGcttccaagctgctgtcgcatTGGCTTCGCTTGTCACTGCGATCCCATACCGACTCAAAAACGTGCTGACGGATTGTCTTCGAGGTC
TTCGGGATACTGCCGAGTACTTGATGCGCGGAGGCTCGGACGGCGAAGATGTGGGAAATTCAGAATCAGCTGAAAGGACAGAAGACGGTCAAGATGAAGG
CAACGACATGCAAAGCAAGACTCACTTGTATGCAATTCAAGGAAGATCCGCTGCAATTACTCATATTCTCCGCGCCATCAAGCTTGAAGCAAAAGGGGGG
TTATCTCAAACAATTATGGACGATATTTACGCCATTTCCGAGGAACTGGTTGAGAGTCAATTCCTCAATGAATGTGCCGATAGTATCTGGCTCACATGCA
CGCGCGCTGGTTGGACACTGGTGGGAAGTCTTGTGTCCATGAACGACGAACAATGGATAAAGGCCAATTTGGAAAAGCTCCTGAATCTATGGCTCAAGTC
CAGTGTCCTACACAGTCGTGAGTCATCTCTCGAACTCCTGCGCATCGAGGCCGCTGTGATCGCACTAAGCAGTTTTCTTGTCAATTGccaagacgtcgct
gttgACCCTGACAGTGATGTTAATCTTCTAGCAAGTCACGTGCTACATGTATATCTGACGGCGACTCAGGACACATTGAGCAACCCTCTCAAGCGCCGCG
GTCAAATCGCCCGCTACCGGCTGATAGGGTGGATCATTAACTGTTTCTCGATGCTCCCACCGATTTACAGTGACTCGTACATCATATTATTGGATTTGAT
TGCCGAGTTCACTACGGCTCAAGCGCTGACAAACCTTCGGCATTCCGCACTGGTGCCGGCGAAATCCACGTATTTGCAGAGCATTCTTTCACCAGAGGAC
AACACACTTGACATGATGACCCTCTCTCGACTCGAGTCGGGGGATTACCCATCTCCGGTGTACTCAAGGGAGCTGAATCATGTGCTCggcttgcagcagc
gagaaaACGCTTTGACAGACACTGAACTCGAGGTGCAATATCTCGACACGTTTTGGAGGGGGATTGCTGAAAAAGACACTGTGAACAGTGCAACCAAACA
GGCAAGTTGCAGCCCGTTTACTTACGTTCGACTCGTGGATGCCAGCGTGCTACTATTTGGTCGACTGTTTCACTTTATTCCAGAAGATCTACAGCTGCGA
TGCCTCCAGCACTACGCAGGAGCCCTGACTGATGTTCGCGCTGATTGCGAAGTCAACGTGTGCTCCCTATTATTTGCCGTGATTGCAGAAGGGAGGCGCC
TCGAAAAGACTGATACCGCACCAACATCACCCGTGTCGCTTTCTGCGACATCGTGGCCACTTCAAATGCAGACCATGCTATGTGAAATGATTTCAAGTGA
AAACGCAGAGGTTCGTCGCGGTGCAGGTGAGGCGTTAGGAACTCtagcgctgcttcttggggAAGACCATTGCAAGGGGCTAATTATCGAGTTGGAGAAA
CGCTTGGTGGTGGATAAGCTTCCGCAGGGAGCCTCTAACGCCACATTCGGCTCCAACGCTGACCTGGACATGTCCATTTTatctgctggcgctgcttttG
CGTTAGCCTGTATCAAGCGTGTTTGTGGCTCCCGCATTTCTATCGACACGGGCCTCATTTTCCGGTTTGCGAGTGAATTTTCACAACCTTTACGCACATG
GATCCTGCATTCGTGGGGTATTATCCTCGAATCCGTCAATGCTACAGGAGGTGACTACGAGCAATTTGTAAGCTCAACATTTTCTCTCATGGAAGTTCAC
GTTCTGGCAGGTTTTGTCTATTCAAAGGTCAACAAGCGGGGACTGAAGTGGCAAATTAGCACAAAAGTAGCGTTGGGGCGGATTATTAACGACGTGGTGG
CAACGCTTGGACCAGAACTTGGCGGCTCTAGTGACCGACTAGATGAATTTTACTCGTATTGGatgcttcttcgtcaagaTGGCGACGCACGTGTCGAGTT
GGAGTTCTTGAGGTTCCTGGAGCAAATGGTCGTTTTCGCGCCATCTCGCTTTCAATCTGCAGATTTGAGATACATTTTGTGCATCATCTCGGATACTGCT
CTGTTAAATTCAGTAACCCCAGCTTCGCTATCTGCGCAACAGAACGTGGAGTCCCCAGTTCTGTCGCCACCGTCCGGCCCTGGTCCCTCTCTTGCTACAT
TTGGTGCATTTGGGGAGCCATGCGAACAAAACGGTCTCGTGAACGTTGGCGTATTCACAAATGGATGGAGTCGGAGTATCCTGCAAAATGTCGGGCTGTC
TTGCATCCGCACACTAGTGGAAAGGGACCCGGGATTAATTCGCCGCCAGAATCTGTTCTGTCTTCTGTTTTCGGCACTCCATGTTGAGCACAACGAGCTT
TTGTGGGGTTACTTGCCTGGGCTTCATGGTATGTTGGACGTGCTCTCCTTCGCTTGTGCTGATTCTACAACCATCCAACGAAATGGTATCAACGCGCTGC
AGAGCACAGCTCTGGCACTACTTGACGTAGAAGGTAGAGATCACGAAGGCGCCGAACCGTGCCTATGGGCTCTTTTGTGTCGTAGTATTGCCATTGGGGA
GTCATCGAGCACTTTTTCAGGCGCTGGTGAGGATCAGCTGATGATGAGCCCGAGAGGGATGAATTCTGGCATCCAGGCAGCAGGAAATATGGAGACTTCA
GGAGATGATAGTACTTCCACGCGGTCCCTTGATTTGCCTAACGCTGATGTTAACTCGCTGGTATCTGCTGCTATTGTCGCTCAAGTGAATACCTGGCGAG
CTACAAAGGCAAGCGTGGGTGATTTGATTGCGCTGATGCCTCCACTTTCGCGTCAAGTACGCTACTTCGCGGTGGAGTGCGTGTTACGTGTTTTTGAGTT
GATGGTGGCAACTCCGCCTATGGCGACTGGCATGTGTCAGACTAAACAACTCCATTTTGATCTCGCTGCGTCACGCCGCTATTTCTTCGAGGTGCTTTCA
GCTGGGGCTGTGTTGCCGGCGTCCGCCGATTTCAGCATTGGGAATTTTTTGTGTATGTATTTGGACGAGTTTGTCACTCTTGCGTGCCACGTTAGTACGA
CCTCAGCTGAAGGGGACGAACTGCTAATGTTCCAGTGTGTCGGCCTTCGTCTCCTAAATGTGTTGGTGAAAAACTTTGCAGATGCACGTGATCCGGAAGT
TGCCACAGGGGATGCTTACTTGCTGGATCCATACCGTGCTCAGCTTTCGTCTGCCATCCGTCATGCGCTCAAACAAGTACAAGTGGAGTCTTCATTGCTA
AACTCCAGCGTGGAAACCGAGAagagtgaagaagaaagataTTTCTACGCGCCATTACTCCTGGAAGCGCATGGCGTCGCGGGTGCCTGCATCTCTGCTC
ATCTTATTCAAGATAAGGTGGGATTGGGGCGCATTCTGAGAGCAGTCGTGACTCAAGATTATGGCCATGCCCATTTCATCGGAGACGAGCTCACCCGTAC
TTCTCTTTCGCTTGCGAATTTAGCTTCTGTTGGAGAACTCCTGACTTCCAGTGTCACGGTGGCAATTGCTCAAAAAGATGCGCGCGACGATGAACGTACA
GCTATTGCGACGTCTCCTCTTGTGAAAGCCATGACTAGCGGTTTATCGGGTACCACCGAATATCTGTTCAAGTGCTGGATGGACATGACGTTCGCATATG
GAGTTGTGATGCAAGGTTGTGCACAGTGGGCGAAGTTGGACGCAATGTCGAGCACAGCTTTATTGCATGGCGAGCTAATGATTATGCCAGCTTTACAAAT
GCCCCTTCCACCAATCGGGACTGCTGCGAATGCCCCAGCGGGTGCTTTGGAAGCCTCCAAAACTCTACGCACGCTATTCAAGCGCTACTGGCCATCGATT
GTCAATGCGATGGCAACATTGGAAGTCTACATGCCCAAGTCAGTTTCTTTGTGCAGTACCCAAGAGAGCAACATTCCTAAATGgtcgtccgtgctgctgt
ccagCGCTATATTCCATGTCAATGCGAACGCTCGCGACCGGATGGAGGACGAAGGGGAACTACCGGCAGTTCTCCGCAGCATTCCCTTGCTTCTAAGGGC
TTTAGTGGAGAACCCATTCAGGCAAGATTGTTCTTCATCCAGTAACTTCCCAGTGTTCTTGACAACTGCACTGAATGCGCTCATGCAAGCAAGTAAACGG
TGTTCTGGCGCTGCCCAAATTGAGGCTTTGAAGGCGATGTTCTCGTGCTTATCGCGTGAGAATCTTGCTTTTGCTAAAGAAGCTTGTCGCTCTCAAgagg
acggcgagcagctctGTGCTACACTTTTCGCTACCGTAGCACAGGCTGGCCTGTGTCCAACAGAGGTTGTGTGCCAACTTTGCGACGCAACCGAGCAGAC
TCGACATGCTCGCGCAGTGAGCATTGGCAGCAGAACCGCGGGATCTCGTCGCAGTTCCATCGCAAGCGAAGAGGACGCCAAGCACATGACTGAAGTCGTT
CAGTTTGCTACAACTGGTATTGTCCTTCTGCACACAACCGAAGAAGCGCGAAGTGGGGTGGTGCGCTCAGTAGCCATGGTGCAGCAGGCTATTTGCTCTG
TCGCTGGTGGCTATCATTCTTCTTCAGTGAAGGAAGCTGTGGTGAACCTTAGCCGCGCTTCCACCGAGGCGGTGCTTGCGCTTGCACGTACTTTGGAGAC
GGCCAATACTTCGTCTGATGGTGTTTTAAACCGGATCAAGTCAAGTGTACGCAGTTGCTTTGAGTTTCTCACTGAATGGCTCAAGGTAGACATCCACACT
GCTCCAGGATTTTCGATGCAGATCGCGGCAAATTTTGCTGTGAATTTTCCGGCGTGCCTGCAAGGCGATGCGGAACGCTTTCATGCTGAGATTGCTGAAA
CGGCTTTGTCGATGTTGGAGCTTACACctgacgacgaggatgcTAGAAagcagcagtttgcagcTGCCAGTGCAGAGCTTCTGCGAGGTTTGCATGGTGT
TTTGAAAAGGCTCGTCGACCTGCACCAAAGCTCTACTATGAATCGATATCTAGTGGCGCTCGGTCCTTCCCTCATCGAGATTGTCGGAGCGACAAACGGC
TACCCAGACACAGCTGCCGAGCTCGCTGAATTGGATGAAGCGGAGGGACTTCTTCGCctgctgacgacgcagtTGAACGATCAGCACGGTGCCGCGTTTG
TACACTTGCTACTTCCTAGACTTGCAGCAGTGCTCAGTCACCCGCTGCCGTCATCTGCAGATAACGCCATTCTTGCACAAGTTCCCGGTATCCTGGCCCG
GCTTCTCCTCTGCTTTGCGCAAACCCATGCATCGGCTTTCAAGGAGGCAGTGGCCGCCATGTCGCCTGCACTACGTAGCGTACTGGAAACTGCTCTTCGT
CTCGCTCTCACAGGCTCGGTCCCAGCCGCTGGATCGCGCGTGCAGCCACCAGGCCCCAAAGGTCCTACTGGTATCAAGCTTGACCTTAGTCGATACAGCT
AAGCTAGAATGTTGAATGTTGGAATGAATTACACAATGTATGGTGAACGTAGAGTTCTCTCGATGCTGGATCGGTGGTCTTGCGATTGCGTATCTGCAGT
ACTTTGTTATTTGCTCAGAGCGTCGTCTCTGGACGTGAAGCCGTGGCAACGTCTTGCACTGCCAGTAGCTCTAGCAAGCTGAACAGCACTGTGTGAACGA
GATCCATGTTGTAGAGCTGATGAAGAAAACAACAGCGCAAAGCTCGAGTTAGAACGGCACGTTGTCGTCACAATTGATATGGCTGGCAAAACTCACCTCG
ACTCCTCCATCCACATCTACTGTCACTTCCTGCATCTCGACACGCTCAATCTCGTAGGTAGACAGATCAAATGGCAAAGAGTCGATGTACAGGCGCTCTG
TCAACTCGATCAGCTCTGAAAACAATAACAACAAAAATGTCAGCAAAACGACCAAGCCAATCCTCACATCGTCACGAACCTGGTACGTAGTTAGACGGCC
GGTTGCCTCCAGGTCCGTCTTTCGTCTGCTGAAAGAGTCGACGTAGCGTGGCCCACGGCACCGTGAGTGTGTATGTGCGCACAACGTCCTCTTCCTTCGT
AGCTCGGTACTTCAACAACAATGGCGCTCTCGGCGGTTCTTGCGCCGCCATTGAGCTGCCTCGAGGGTATTctccttggtcttcttcctggttaTTCGAC
TCACGCTGGACACTTGACGCTCTCGCTTCTTCTGCCAATAGACTCGCCACCGCCCAGTTGCGTGCCAAACGCTTAAGGTTCATCTGCTGAATGTGCACCA
CATGAGTGCTCACCACGCATTGAAagcggcgctgcagccacgagcAGACCCAGCGCAGCAACTCTTCGTCTCCTCTCAATAGCAATACTTGGTGTCTTTC
CCGTCCTTTACGCGGGGCTCGCTGCTCTTTCTCCGTGGGAAAGTAAAGCACGAAGCCTCCCGTACGTTCCGGAGCTTCTCTCTGAGCCGCAGAAGCTCCA
GACGGACGCGTGCTTGACTTGGCTGCTCTGGTGCGACTGCGGTCGCGCTCCTCTCGGATCTGGAAGGCTACGAACGCGTCCGTATTGCGGATGCTCACGC
TGTAGCCGAATTGCTGGCCACATGCACGCAACGCCGCCGCGCGCAACGTCTTGACCAGATCATGCGCATAGTCGCTGAGCTGTTCGCGGTGGAAGTGGAA
AAGTGGCGACGCACAGTGGAAGACCCAGCGACGATCCAGCAAAACCTTCTCCATGCTCATTTGCTCCTGTTCTCGACGTGCGGCGGCTTCACgcggcgtc
tcctcctttgCAGCGATTCctcgctcgctgtcgacgccgTCTTCGGGGGCACGCATGTATTGCGTCGGTCTCATGGGCGAGCTGTAGGCCTCGCGGAgct
tctggtgctgctcggGCGTTGGTCTGGCCGACGGCGGCTCGGGGCGAGAGTTCTCCATCACTTCAGCACTGCTGGTGGGACAGCAGCTTATTGGCATCTG
ACGTGCTGAAGACCTGTCGTAACGGTTTGTGTGCAGAGCATGGGGTGGAACAACattgtaaaaaaaaatcggATGAAATTTTTAAGCACGAACGTCATGA
CTTCCAGCTCGACCATTTTTCCCTGACTACACCTACGACGTCGCTAGTTTATCCACCGGccaagaggaggaagatgaggatcaccacgagcaccaggATG
ATGATGTACAgcttggtgttgttgctttGCTTGGCCACCTGAGCAAAAGAGTCTCAGTTAGCACGCGTGGGAGAAAAATAAAGCATGCAGTAGACTCAAG
TAAGAACGTACCCGAGCTGCGCGCGCACCCTCGGACTCGAGTCCATCGGTAACGCGggacacgtcgtcgtcgatctctCCCAGCAGCCGCAcgtgcagct
ccgtctcgtccttgacgGTCATACTGTAGTTGCGCAGGTTGGATACGCCCTGGCCGATCAAGTCCAGCTGCTGGTCTTGGTCCTTCATAATCTGGTTCTG
CATGCTCAGCAGTCTCGCCGGCGCATCTGCCGATCCAGGACTGCTACCAACAAAGTGCAAAACAATTAGATCTCCTGTTCCACCTGCTCTACCATCATCT
CGACGCACCTCACTGCGGCCCGTGACGTCTTCCGACTGTTATACATATCCAagtcttcttgctgccgttcAACAATCACACGTCAAATTCAAAGCTCCAA
AAGAGCAATCGCGTGGAATGAAGACTTGCGTTCTACCTGGTCTCGTGCTAACTGATCCAGCAGTCGTTCACGCCGTTCAATCTCCTGCGTCGtcctgtgc
agcagcaattaaTTATTGATTGTCAGTAGATAACCTTCTTCTAGGTAGTAACTTGCCAATGGTTGCGTCGTACACTGAGCTAGAGGAACGTTTGAGCTGG
TCGAAGTCGCGCTTGAGCCGCGagacgctctgctgcagcgcgaagacGCTCGTGCCGATGGAGCCCGAGTTCCCTGTGCGGATCTTGCTGGACAGCACCT
GCTCCTGGCCGCGCGCGCTCTCCAGCCGATCCAGccacgacgcccacgccGTCGCACTCATTGCCGCTTC