Description :
From Genome Similarity Track
Location :
Scaffold_229:6047- 10091
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_229-fgenesh-gene-0.3Pc20g04080 protein
Pytul_var.sporangiiferummaker-pug3_contig_229-snap-gene-0.19Stress-induced protein sti1
Pytul_var.sporangiiferummaker-pug3_contig_229-snap-gene-0.14Conserved gene of unknown function

Sequence
4044 bases(100 bases per row)
CCATACCGTCCAGTTGCACCGCAGCGCACTTTATACACGCACACAGCAGCGTATGTATAGACACATAAGTAGATAGATATACGCAGAGCGACTGCCGCCC
ATCGCCAGCGTCATCGCGTCCATTTTGCTGCTCCATACTTCTCCGCATTGGCTTTTTCTGTGCATGACCTCTTCAATAAAAACCTCAAAAACGAGGTTTT
TCCACCAAAGATTCGAGAAACTCGGATTCGGCGCACATTTTCAGCCAATAATATCGCGTGTAGTCATACTTTTTTATCCAATGCGGGGGGCGAGTTTATG
TGGCCCATGTGATCTTGCGGCAAATTGAACCTTGCGGCATTCCGCATTCTGCCGAACAGCTCCGTCCGCATCGTACAGCCCATCATCCAGCATGCTTGCC
CGTGTCGCCCGCGCCGCGTCGGTCTCCATGACTAAGCGCGCCTCCGTCACCGCGCCAGCGCTCGGCGCCTTCCAGCTGCGCGAAAAGTCTTCGCTCACGT
CGCTTCTCAAGGTGCGATAGCGCTTCTGAATGATGCGATCGTCACTGCCGTGACTTCTATATGTGCGCTCATGTGAAGCTGTGTGTTCGCTTACGACGTC
GATGATTTACTTGTGATGAATAGCGTGAGATTGAAGAGGAGAAGGGCAACTGCTTTGAAGGTGAGGAGCTCGAAGAGCTTCACGCCAAGATGAACAGGAT
CTTCACCTTGAAGGAGACCCCCGGCAACATGGAGATCGTGCTGACCGGCCAGGTCGGCACCGACTCGATCCGCATCAAATTCGACTCGCAGGACGTGGTT
GAGTTGGAGGAAGACTACGTCGATGAAGACGAAGAGGAGGAAGAGGAGGAAGCCAACTACGATGAGGAAGAAGAGGAAGAGGACGGCGAAGAAGACGAGT
TGCCTGGCATTCGCTTCGTCGCGGACGTCACTCGTGACAACCAGGGCCTCCAATTCGAATGCGTTGCCAGCAGCAACCTGACTGTCGAGCGTGTGCGTTT
CCTGAGTGATTTCTCGGCCAACGCCGAAAAGGACAACCTGTACTTTGGTCCAAACTTTGCCGACATGGAGTTGGACGTGCAGGAAAAGTTCTACGATTAC
TTGGCCGAGCGCAAGATCGACGATGACTTGGCGCAATTCATTACCCAGTACGCAGACCTGAAAGAGCAGCGCGAGTACCTGTCCTTCTTGGAGAGCGCCG
AGACGTTTATCAAGAACTAAGCAATAGAAACAACAGACACGCACAGCCTCGGGGTTACTTGTACCGCATGTAGTAAGCACACAAACACACAAAAACAACG
GTTTAACGCTAGCCTAACACACACAAAAACCTGGAGTTGTACTTGGCATGTCGCTTACAAAGCTAGCAATATCTCTTTTTTCTACCGCCACATCGTCACG
CTGCTTCCGCCGTGGCATCGCGAGTACTTTATTGCATTCTAGACATGACGTTCTGGAGAAGCTGCGAGACCTTGGGGTTGGACATGTGGCGCATGGCAGC
CGACGGACCTTCCGAGTCCACGTCGCGGAAAAAGTCCTGCAGGTCCGGGTCCGATCGCGCCGCNNNNNNNNNNNNNNNNNNNNNNNNNCTCGGGGCTGTT
CATGAGGCGGCTCATATCAGGCATACCACCAGTGCCGCCGCCTGCACCTGGAGAGGCGCCACCACCCATGCCGCCGAGGTTGTTCATCATACTGCTGAGC
ATTTCTGGGTTTTGCATCATGTTTTGCGCCCTGTTCGCGCCCAGACACAACACACATAAGCACGCAGTGAGTTCACATCCTTCTCAGCCTCGAGGGCAAC
TTTGCACGTACATTTGCATCATTTGAGGATTCTGCATCATGCTCGACGCCATTTGCTGAATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGCGGTTGTCTGCACT
TGGCGACGCTTGCGTTCAGCTTCCGCGAGTCCGTCCTTGCAAGCCGCGTTTGTGCTGTCGACCTCCAAGCCGCGGCGAAATGCGTCAATCGCACCGTCAA
AGTCCTTGAGCTGCACGTACGCGTGGCCCATACGAGAGTATGCCTTCACATACGCAGGCTTCAGCGCAATCGACTTCTCCGAGTGGTCGATCACTTCGTC
GTACTTGCCCAAGTACGTCAGCGCCGCCGCGAGGTTCGAGTGGTAGATGTGCGAGTTTGGACCAGCTGGCGACAGCTTGAGCGNNNNNNNNNNNNNNNNN
NNNNNNNNNNCTCATAGTGCGCAGCCGCTTGCTTGTAGTCTCCTGCGCTCAACGCCGAGTTCCCTTTGCCCTTGGCCTCTTCAGCCTTGGCTTCCTTTTC
TTCCTTCGACATAGGTGGCTGCACACAAACATACGCAGTTCACACGATCAATAACACGCTCATCACCAAGAAAAAGAGTCCAAACAGACTCGATGAAAGA
ACTTACCGCAGCAGGCGCTGGCTTCTTGACGTCGCCAAATTTCTCCTTGAACTTGGCCAAGGCCTTCTTCAAACGGGCCGTGTGCTCATCCGAACCCGCC
GGCAAACCGTTGAAAAAATTCTTCTCTTCCAGCTTGGCGATCCACTTCTTCCACAGGTCAGGGTCTACAACGCACACACACAACGCAAGACGGCGTAAGT
GCGCAAACATACAGACTTGCGCTTCTACTCATAAAAGCGATACATCATCGTACTTTTCAAGACAACAGGGTCTTGGTCCACCGAGTCCAAAGGAGACGCC
TACAAGCACGATGAGCAGTAACAGTCAGCGCTTCCACAATGGCAAGAGAGACCCCATACTTCGCCCAGCACTCCATATGCAGTGCACATACTGCGCCGAT
TTCAATGTTAAGCGCCTTCAGCCCAGCCGCAAAGATGTCTTCGAACGTAGCCGAGCCGCTCAACGCATACGTGCGCTTCTGCTGCTCATCGTGCACGTTC
AATTTAAACGCCTCGCTACACACAGCCACAAGCAGCATACACACAGTCCCATTCATTATGCAAAAGGCCAGGTACACAGAAAGCACGTCAGTCATTTGTC
CTTCTCCTCGCTCCCACGTGAGCTTCCACTGCGTCCAGCGTGTCGTCAATTGTTTTGCCTAATACGGCACACGTTCATGAAAAAAGCACGCACCTGAGGC
ACTGGACGCCGACCTCTACGTTATCGGTGTCGACTGCATCGTCCTTCTTCTTGTTGTCGATCCACGCGAGCGCGTGGAAGAGNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNGGCCGCATCCATGGCCATTTCGTTCGTTCTCTCAGTCGAATATTCCAAAAGTGTCGCGTTCCTCCCTTCCGTTCCCCCAAGC
AATCTTTTCAGCCAATCAAATATTATTCTACATAATACCTCATCAATAATGCGATGTGATTCGTTGAAAAGTACGACAGAATAAAAGATTGCGAAGAGCC
ACGATACCAAAATGCGCCAACATGGAGCCCCACTGGACGGGCAGCGAGGACGACGAGGACGAGGCCGCGAGTACGAAGGTCGCGAACCTCGCGGCGCTCG
AGCAGCGCAGGCACGAGGTCAAGAGCAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNTCGGCGTACTTTCTCGAGCCGCTGCCGCCGGATTACCCGAGCGCATCCATCCACGATCGTCTTTTCCAGTGCCACAAGGTCCAAGCCTCACAGGT
ATGGCTGCGTCATGAGAAGCAGCTGCGCTTTGAGTTCGATCCGCCAGACGAGTACCAGCTCGAGTGGCGAATCTCAGCACTCGGCAGAGAGAAATGTGCG
AGCGTGTTCGAGCGCTTTGACGTGGACGAGGATGGCGCGTGGAACTACAGCGAGTTCCTCGAGTACCTCGCCGCGCTCGAGCGGGAGCGAGACCGGCCAG
ATATCCGCGCGTTTGCAGATGACCCGGAGGTCTGGCTCATGTAC