Description :
From Genome Similarity Track
Location :
Scaffold_59:60465- 65066
Transcript NameFunction/comments
Phyci_81667DNA polymerase epsilon subunit, putative

Sequence
4601 bases(100 bases per row)
TTGACCTATTCGACGCGGCTGAACTCGGTGGTGTTGGTGCTCGGACGGTAGAACACGAACGAAAAGTCTGCGTGGAACGGACCCGGGTGGAAAACACCGA
CGGACGAGTAGCCGAGCTGGTACTGCTCGGTCGAGTCGCCGAGGATCATCACGTCCGGGACCGGGAAGAGCTGCAGCGATGAGTCAAAGTCCCAGTTGAT
CGGGTTCGCCATCAGCGGCAGCGGGAACAAATGTGCTTGGTCGATGAGCGTCTTGGCCAACTGAAAGCAGCCACAAAAGCACAAAGTCAGCAACATTGTC
AGCAAGCGACTACACCACTTTCAATCACGCAAACGCGGCGTCGTACATGCTTGGAAATGTCCGTTTGAGATACCGACTGAACTGGCTCGCCGCTTTCGTC
CATTGCAGCTTCCTCCTGCTCGCTTGGCATCGGCGTCAGAATAGCGTGCCGCTGCATTTTTTGCTGGAGGTCGTCACGGAAGATCACGATGTCTTGTGTG
TAGTAACGGATCCGGCATGGGTTGGTGCTGCAGGTGACATTGGGCACCTTTCGGATGAGTTCACGTGTGCACAAATCGGGAAGCTGTCACATCATGCAGC
AAAACAAAAATGAGCTTTCACTGCAATAAGATACGGCAAGCTTGCTTCACGTACCGGGTGGCGCGGGAAGGCTCGAGAAGAACCCGGATCGTTAGGTCCC
GGGACTAATACGAACCGCGAGTTCTCAGCGATCCCAGGGTACTTCAGGATGAGGTTTCCAAGCTCTTCCAAGTACTCTCGCAGGTCTTGCAGCGAGTTAG
ACCCGGCGCCTCCTCCGACAGAAGTTGACATGAAATCGCCCATGAGAATGAAAAGCGTAGGCTGAACGCTTTCGAGGCCCTGGAACAATTCGTCCAGCTT
ACTCATGACCAGTGGATCGTCCAGATGAACGTCGGACAGCACGATGAATGTGGCATGATGGTCGCTCGCTTCTAGTGCTCGGATTTGTTCGCGCTGCTGC
GCTGACACTTCCATACCAAGGGGATCGATGCCACCGAGGACTTCCAATGATGCTTCCTTCGTCTCTGGGGGTGGAAAGCCCATAGACTACAGTTATAGTT
GTAATGTTAGATGCCAGAGTCGTGAACCCTGAAGTAGCAGCACAAAATCCTACCTGAACGTGAAGCACATCGTCAATGACTTCGCCTTCCACCAGTACGA
CGCAATTGATCGTGAAAAGGCCGTCAGTATAGGCGGCATTAGTAAGGTCGACGATGATTCGCGACGTGAAGTCCTCCAGGTAAAATCTTTTCCGCTCGTC
CTGGCCGAGCATGCCAATCACACGTCTCACTCCGCTCACACCCAACAGCGATTCGATCCTCGACAGCTACTCACAACAATTAGCAACTCAATTGAGTCTC
TACCAGCCACAAACTCTCCACCCATGGTAAAATACCTACCTCCATGTACTCCGTGGTGTTCGCTACCGCAGCCGACGGCGGGGCGAAAAGTCGATTCCGC
TTAACACGGAGGTCCACGGACATGAATCTGTTCCTCAGCAGCTGGATCCTGGACTCCGGCCCACCATGGAGACGACGGTGGGCGTCCGCCTTCAGCTCGT
AGGAATTGTTGTGCGAGTTGAAGTGCAGCCTCGGCGTGTCGAAGGCGCCGAACACCTGGATCTGCTCGTAGTCGTTCTCTGCAGAGACGGCCAGCAGCGT
GTCCAGCGCGCTCTCCAGCGCCTCCAGCGTCACCACGGACGTCGTCACTGAGAATGCAAAAAAAAGTATCACAAGTTAGTCGTGTGCGCCAGTTTAATGA
TTTTTTAAAGTATTCCAGAAAGTAATCGCACTCTTGCTGCGGTCAATGTTGTTCTTTATGGCGTAGATAACATCGTCCAGCTGGAGCGAGGCCTCACTGC
GCAGTGGGGTGCAAGATATTGTGCATTTTGTTAGAGAGGCTGGGGAATGGGAGTAGCTGGCTATGCCGTATTGTTTTGACGCCTCTGCTGCGCATCTGGA
GGTGAAAATTAGATGGACCGAAGCGCAAGACGCATACGCACTTGGTGAGTTCCTCAGTTAGTCGCCGCAGCGCGTCGGCATGCAACGACAAGCCCTGCAA
CTTGCACGCGCGCAAAATCCGCTTGGACGCCATGATTTCGTTTCCTGCGTTTTTTGGCCAAACAGAGGAAACGGCGCCAAATGTATCCATGTACCAGGGA
ATTGGTACGGATTGACACCGATGTTGCAATGCTTAAGTGTATTTTCCAAGATGCAGTCTCTATTTGGTCAAATGCAAGTAGGAGTCGTGTAGATGTAAAG
ACACTCTAGTCCCGAAACTTGGAAGATTGGAGCGAAGAGGCTCTCACAGGCTAGTAGGTTTGGTTGCCGCCTTGGCCCAACCCCAGCACGTAGCTCATGC
TCTGTGCGTCACGCACGGCAGACGAATCCCCCATGGCTGCCGATACGCGAGAGAATGTGTTCCAGCACTGCGCACTTTGAGGCCTCGCGCTCAGACTGGA
AACACCACATCAAAAAAGGATTAGAGAATACTACACCGACAACTTGAATGTCGAATAGCCTTACCGCTCGTTGAGGAGAAGTTTCGCGAGTAGCAGATCA
TCGCACTTGCTAGCACTATACGACGAACCACCGAATGTTACCATACAGGGGTATCGAATGTAGACAGACACTACGATAGGTGCCTACCACTCAATTAGGA
GTTGCTCCACCACGTCTTGGTCCACATCAGTGCCGCCAAGTAGGGCAAGCCTTCCCCGCACTGGAAGTAGCGCTTGGGTTGCATCTTTAAAACGCGCCTA
CATTGACACCCAAAAGTTAAGCCATCCCGTAGAGATAACATGCAGGGTAGTAAACCGTACCTCTGAGTACGCTTGAAACCCTCGGCAAACACTCTGATAT
ACCTCTTCCAGTTCACCTAGAAAACATGGCTCATATTTAGCATGATTCATCGCAAGTCCGAAGCCTGTCGGGCACTTTACCTGGGAAAGCTGGATAGCTG
AACTGGAGCGGGGTAAGGCCCAGTTGTGCTTCCAAGCTGGCAGTATCGACGGCAGGTTCGGCGACTAGCGGCTCGACTGGAGGAGTGGTGCCGGACGGCA
CGCATGCCAAAATGCTCTGCTCAAAACAAAAATGTGGATGTTAGAGCGAAAGTTGCTGTAAGACGGCACCATAGCAGCTACTTACATATCGAAGCACCCT
AGCAAGAGGGTGACAGCGGGCTTTCCCGATATCACTTCCACTCGTGCCCGAGGAAGGTGAGATTGCGGACCAATTTTGTAAAAGCACCTCGCCTAACTCT
GCGGTATCATGGCCAGCAAAACGCATTCGCCAGTACAGTTGAGTTGCATCGCAGAGCGTGGGTACTGCATGAGGGGCGCCATCCGGCTGATACGGGAAGA
TGTTGACTTCCAGCATCTTGTTGATGCGATCGTAGTGACCAAGATCCAGCATATACAGCGCCCACTGGAAGTACAAGTGACGCTCCAGCGGTCCGCCATT
GTCGAAACCTGCCTTGAACTGGTTCGCGTAGCTTGCTCCATGGTTAGCATTGCCGCGCGCTTCTAGGACGTGCAGCATGGTGTGCACTGTCAAAAATTCA
AAGTGGCACGCAATGCAGCCATTAAAAGTGTCAGCAACGATTTCAATAAATGCAAGCCAACCCCACACTTCCTTACACGCCCAACGATCGTTGCCGTTCA
TGGAAAGCGTCTTCTCCGCCAGAGCCTCTGCAGCATCCAGCCGTCCCGCAGCCTGCATTCCGTAGGCTTGCATGCCCAGCAAGTGACTGTACCCAGTGTC
GTTCGGAGACCACGACGGTAGACGGCGCGTTACCGTAGCCAACATATTCTTGTAGTCGCTGCATCATCGCCGTCACAGAGAAAATTCCACGTCAACAACC
ACTCTCCACATCCAGCACCACCCCTGCGACTCGCACCCTAGAAACCGGTAAATATCGTAGCAGCAGCGCAGCGCCAGCAGGTCCGAATGGTCTTGCTGCA
GAATAGTCTCATACACCGCCGCAGCTTCGTGGTGGCGGCCGTACACCATCGCGTCCAGCGCCAGCACGTGCATCTTCTCGGCCGCCGTCGTCTCCCCTGT
agcacagcacaaagcagcacaatacaccacagcacagTCCTCCACATGAGCACCTCGTCCTCGTTTCTAACGCTCCATCGAGCAGGTCGCCTACCTTCCT
GGGCCAGTTTGGCCGCCACCTGCAGCCGAGCAGCGGCGTCCAGCGCGTCTTGGTGCATCAGCGGCGCAAGGCACTGGCTGGCTCCCACCAGCACGTGTCC
CATGAGGAACGGCGCGTCGTCCGCGACCACCTGCTGCAGCATGAACTTGGGGTGCGAATTCATGCTGACGTACTGCCGCCACGAGGTCGGTTAGAAACGT
TAGAAACGTGTGTCATTGACCGGCGAGTGCACTCACATCCAGCAGCGACAGGTCGTACGCCTGCTGCTTGCTCGTGCCGCGGCTCAGCGACGTGTTGCGC
GCGCCCTCGAACTCGCCGATGCCGAAGATCGAGCCCAGCAGCGACATGGCGCGCGTCGAGCGCCCGCGCCGCAGCGGAGCTCCTCCGCGCCTCAGCATCG
T