Description :
From Genome Similarity Track
Location :
Scaffold_107:60464- 62555
Transcript NameFunction/comments
Physo_142024hypothetical protein

Sequence
2091 bases(100 bases per row)
ACCTTGGTGTAGACACACCAAAGGCTACATACATTTACGACCACCACAACGGGTGGTCCATAGAGACTTAGGATTCCTATCGGCTGAGAGCAGCATCTTT
TAGCCAATGAGCGACATGCATAGCATTGGAATTCTGCCAATCAGCCGTTGGCAGATTCCTATCTTAGAATATCACATTTAGAGGAAGTCAGAAACATAAA
ACAAAAATGGCAGTTCTCATTTTAACCCAAAACATTATTTGGATCGTTTATTTAAATTAATCTATACTCGGAGGCCCGAGTATAATTAACTCTAATTTAA
ACTAAGCTACGCTTCCTCACATACACGCGCACACGTGTAAGCTAAAGTAGTGAGCCAAAGTAGGCCCATTACACCTGGATGCACTTTGTAGTCCGTCCAA
CGACCGACTACCTGAGCTCGTACGTCACCGCACGAACGCGGAGCTGAGAACCTTCCCATGGATACAGAGGTGCCCATGGAAAGCTCCACTACGCCTGCAA
CTCACGTTGCACGCGCTGACTGTCCCCACCCGTCGGATCCAGAGTGGGAGGCCCTCCAACGACTGTCAACAGTCATTGGTGAGGCGGCTGTAGCTACGAT
GCTGCGTACGCTAACACCGACAGAGCAACACGGTGTTGCTCTGGGTTTCATCCTGAAGGAGCAACGCGATGTTGCTACTACTTCCGCGGTGTCGTCCGGG
ACGACACAACGCGCGCAATCGCTGAAGCTCAATGTGAGCAACTATGTCGGAAGAGAGGGTGAACCTCTCCTCCGTTGGCTTGTCGAACTCGACACAGCCA
TTGCGGCTCGACGTATCGTCGACCCGTTGTCGAAGGTTGCGTTCGCCATGTCATGTCTTGACGGACGCGCAAGAAGTTGGGCGTATGGACGCCGACTCTC
GGACCCTACGTGCTTTAGCACGTACGAAGGTTTCAAGGATGAGCTCAGACGAGCGTTTGAGCCACCGCAAAACGAGTTCCGGTCGAGGGCGGAGTTCCTC
GACCTGCAGCAGGGCAAGCATGATGTCCATGCTTACGCTCAGAGAGCACGGTACTTGGTCTCGAACATCGTGACCAATCCGATCGACGAGGCGACCAAGG
TCGTCACGTTCATGAAGGGGCTGAGAGATGGGCCTGTGAAGACCTATCTCTTCCGTGAGTACCCAAGTACTCTCGAAGCTGCAATTACTCTTGCAATGCA
GGAGGAGTTTAGCCTGCGGCAGGCTAAGCTGCATGCACATGTGCCGAGGCCACAGCCACGCCCGGTAGTGAGGACGGGAGGCCCAGAACCCATGGACCTC
TCGAGTGCTGCAACTGCTGGACCCCATCAGTCGCAGGGAAACAATGTGCGATGCTACGTTGCGGTGGAGTCGGTCACTTTGCTCGGAAGTGCACGGCTCC
CGTGCACCAGCAGGGTGGCTATCGCGGGCACCGTCGCAACCAAACAAAAAAACGCTGGACGCCAGTAGGCGCGGGGCGCCCTACTGGTAATGCAGTTCCG
CGTGTCGACCTTAGACACGCGACACTGAGGACTGCAGCCCCCAGTGAGATTCAGTCTCGCTGCAAGAACCAAGATGACAAGCCTAACCTTGTCATCCTGA
ATGTGAACTCGATGAGAGCAAACGGCTCTCTCCGTGCTTTGGTAGATTCTGGCGCGTCGAAGAACTTTGTTCGACTGCGAAGTCTATCAAGGCTTGACTT
CGAGGATTTAAAGATACCTCGAAGTATGTTGGAAGTACGACTGGCAACGGGTGCCGTCGTGAAGACCGAGAAGCACATGGTACGCGTGCGCTTCACGTAT
GAAGATCAAGAGTTTGTCGAGACCTTTATCGTCCTGGATCTGAACGATAAGTTTGACATTGTATTGGGCATGCCGTGGCTTGCACGGCATGATCCGGTCA
TCGATTGGGAGAGCGCACTCTCGTGCGCTTCGGTCGCGACAGCGGAACACAATACCTGTTTCTTGTAAACTTTTTTCATCGCCCTGCTGCCGCTACGCAC
GCACCGACAGGTGCGCGCGACTCCCCACTCGAGACAGCGCCTAATGCCGCTGTCCCGGACCGCCCTGGGCGCGCGCGAGCACGCGCGCAAG