Description :
From Genome Similarity Track
Location :
Scaffold_4:60458- 63464
Sequence
3006 bases(100 bases per row)
CGTAACCGATAATCGGGTCGGCAATGGTATTCGCTGAGAACGAACGGGTCCTCAGCAGCTCATCGATGGACGAAAGTGTCCTAGATGAGAAGACTCGGAT
TGAGCGATACACATCCCAATCGTGGGAATCGCTCAAGACAAATCCTCTCTACGATTATTTGACGGAATTCAGGGATGTGTTCCCAGAAACAGTGCCGTTC
GAGCTACTCAAGGATAAGGGTAATCGTCACGAGATAGACCTGAAACCAGGGTCAAAGTACTGTGTCATGAAGCAATGGCCATTGCCTCGTGAACAAGTAC
TAGCGATTGACAAATTCTTTGCTGATCGCTTGGCAGCGGGCCATATGAGGGAATCTACTTCCCCACATAGCTCTCCGAACTTCTGTGTGCGCAAGGCCAC
AGGACGATGGCGGATAGTACATACCTTCAACAAGTTGAATGCTGCCCATGTACCGGCTCAAACGCCGATACCAAGAAAGGATGTCATTATAGATGGTATG
GCAAGGAGTACCATCTTTTCATCGATGGATCTGATGGACGGGTTCTATCAGATTCTAATGCGTGAAAAGGACATCCCGTACACGGCAGTGAGCACCCCAA
GCGGTATGCTTTGGGAGTGGTTAGTAATGCCACAAGGGCTGAGTAATGCCCTTGATACGTTCAACAGATGTGTGACAAATCTGTTGAGACCGGTGCGAGA
CTTCGCACCTAGCTATTTCGATGACGTGTTCGTCCATAGCCGGGCTATGGATGGACAGAAGGATTTGGAAGTCCACCGACTCCACGTCCAAAAGGTTTTT
ACACTGATGCGTGAGCATAAGGCCAACCTCAAGAAGTGTATATTTGCTGCAAGCGAAATACCACTTCTTGGATGCATCGTGGGTAAGCACGGCGTCCGGC
CCGATCCGGAAAAGATCAAGGCGATCACTGACTGGCCGGTGCCTATCGACATAAAAGGACTTCGAAAGTTCCTTGGCCTGGCGGCGTATTTGCACAAATA
CTCGCACAATTACGCCGAGATGACTGTTCATCTCTCTCATTTATTGAAAAAGAACGAGAAGGGCATGGAGTGTTGATTGTCAGCGCTCATTCGAATGTAT
CAAGCAAAGCTTGATACGCTCGCCAGTTTTGGCGATTTCATACCAAGACAGACCATTCCATGTGGTCTGCGATGCAAGTTATTTTGCCATCGGATGTGCA
CTAATGCAGTACGACACAGGCGGTGCTGAGCGTGTCGTCTGCTATCAGTCACGTCAGCTGCAACCAGCTGAACATAACTACCCAGTCCATGACAAGGAAC
TCCTTGCCATGAAGTATGCTTTGGCAAAATTCAGGGTCTACCTACTAGGTGATCGACCCTTCATCGTATACACGGACCATGCGTCCTTACGCACGGCCGT
TAACAGTCCACACCTCTTGCAACGAATGGCGAGGTGGCTGTCGTTCTTCGCGGAGTATAACTTCTCCGTGGAATATAAACGACTGAATGTCGTCGCTGAT
GCTCTGTCGCGCCGGCCCTATTTCGAACCGGCTGCGCAACCCGACACTGGTCCGACTACTGTCGCGGTGTTGACGTCGAGTGTCCCGTCGTCAACCTTAT
TCAAAGACATACGCAAGGCGTACGATCTAGCGATAGTGCGTTTGATAGATCATCTCTCGCAATCATCCCGTCAATCTCTTAGAAGGTTGCCCCCAGTATA
TCGATCCGTAAAGGATCGATATACAGTCCACAATGGATTACTGAAGTATTCAGCCTTTTCCGGCGACACGCCACGTGTACCTACTGGTGGGCATCGTGGT
CGAGAGAAGACATATCTCACAGTTAGTCGCGACTTTTACTGGCCACGCCAGTATCAGTTCGTGCGTAAGTACGTCCGCGCATGCGAAGTATGTCAACGAG
TGAAGTTTGGTCCTTCACTTCGTGCGCCGTTGCAACCCTTGCCCATTCCGACAGAATGCTGGGAATCAGTCTCAATGGACTTTGCCTTTGGATTCCCCGC
AGACCCACACAAGAATACAGGTATTCTTGTGTTCGTAGATAGATTCAGTAAAATGGTACACCTGGTTGCTGTACCTGAATCTATCAATGCATCGGTATGT
GCTCGTGTTTTTATCGACACGATCTTTCGTCTTCATGGTTTGCCTCGTGAACTCGTCTCTGATAGAGACCCATGATTCACTGCGGAATTCTGGCGATCCG
TGTTCAAAACAATCGGAACGCGCCTACAGATGTCGACCTCTGAGCACCCTGAAACAGATGGTCAGACAGAACACGCCAACCGCGTTCTTGAGATAATCCT
TCGGGGTTATGTCCATTCGTTTGCGAATTGGAGCGAATTCTTACCAATGGTGGAAATCGCCATCAACAACTCGGTGCATGCATCGACGACGCATACACCG
TTCTTCGTGAATGGATTGCGCCACCCACTCCTACCCACATTCTTAGAGTGTAACTCTCGTTTAAGGGGGGGAATCATTCGAGCGATTGCCAACTCGGCTC
TCACTCATCACGTACTGACCACGAGGTCACTACGTATGACGCCGATGTCGATCACATCGACTTCGGTGAAGAAGAGGAAAGTAAGAGCGAGGATTCTCTT
ACTACCCAGGTCACTGATCTTGCCGCAGTGCGCTCCAAGCGCACTATATCCAAAGACAGCAGGTCAGCAGATGAATTCATACTGGCTCGCGAAACGGTTG
TCCGTTTTGTGCAAGATTCCATTGCAGAAGCAGTCGACCGACAAAAGAAAAACACAGACAAGAAATAGAACGTCAAATGTTCTTTCATTCAATGAAGGTG
ACCTATTCCTACTATCTACGGTAAACTTATCTCGACACATAGTGACTAACGTTGGTAGTAACAAGTTACTACCCAAGTTCATCGGTCCATTTCGTGTGCT
GCGCCGCATAGGCAACGCATACACGATTGAACTGCCACATAAGATGCGCACGCATCCTACGTTCTACGTCGGTTGCCTTAGACCTTATCACCAGTACGGG
ACTTCT