Description :
From Genome Similarity Track
Location :
Scaffold_1443:6045- 7270
Transcript NameFunction/comments
Phyag_g10641hypothetical protein PHYSODRAFT_247331

Sequence
1225 bases(100 bases per row)
GGATCCCTTCTACAGCCACGAAAGACTCGGTGAGAGCATTTGAATGCTTGCCGATTAGTTGCTCGTCCATCTTGCCGGTTCTTGTGTGTTGGAGGGCGAA
TAGAATTGTGGCTTCTAGCGAAAGGCGAACGATCTCACGCAAATCTTGATCGCGTCAGTGGTACTGCAAACGTAATTCGAGAGATGACGTCGTTCATTGA
CTGACGTGAACATCGTGAGCTGTAAACATCTCAACTAAGCAAACACTCATCAAAAGCAAATCTCGGGCTCAAGCTTCTGTTTCGAGCCGTCCTAACTCGC
TGTCCTGTTAAGAAAAAATAATCCATGCTGTTGCACCTaccgcttcttcgtcttctcttcAAAATGTTATCGTGTCAGCAGATGTCTTGAAAGCGAATTA
CTTGGTCTGGAATTTGGCAACATcgcacctcctgcagctcgttgaagGAGCCATCCCTTTCATCGCGTACCTGTACGGCGAAAACACAAACTTCGTCTTG
CATCCGCAGCACTCCAGGGTCTCCTTCTACATCTTTTGTTCATGGGCGGCAAAGGGTTTTGTGCTTTCCGCGATGTCGTggcagcaccaacatcaTTTTG
TAAAGCCTTCCTACAGGCCGAAAAGTATGCAGATCTGGTGACAGATGCCACTTATCCAGATCTGCCTGCATTGAACGATGTACGCCTGGAAGAACTTGTA
GCTGGTGCAATTGTTGCAGCCAGTCGCCACAACGGTTTTGGAGGATTAAAACACTGCGAGTTTGGCGATTTCCTTGGTGCTCTAATGTTTGAGCTGAGTA
TGAAGAATGACTTTCTGGGGCTCGTGAACATTTTGTCTTCTCTATCAGTATCAGTGCCGAATTGTTTACCTCTCGACACAGGACTGCCAGCGTTTCTTGA
CAAAGCGAGCTTTGGAAGTATGAAACGAACCAGGGAAACAGACTTTACATTTGCTGGTGGCAAAGTTTCTGTGGAGTGTGTTGGGCACCTAACACCACAA
GATGAGCTAAAGTACGCTATTAATCGAGTACCACCAGACAGCACCGTCCATTTCATTATCGCGAGGGCGCGGCAGAAAATGCCTGCGGAAGGTCAACAGG
GCGACGATGATATTGATGTCCTGGTGAAGGGACTATCACGCCTACACTTTGCAGCTTTCCCTCGGGTCTTCTTTTTGCAGATAGACGGGGTAAATTTTCA
GGAAATACAGGTCACCCCGATGATC