Description :
From Genome Similarity Track
Location :
Scaffold_286:6043- 10709
Transcript NameFunction/comments
Phypl_g6458sphingomyelinase phosphodiesterase, putative
Phypl_g645960S ribosomal protein L23a

Sequence
4666 bases(100 bases per row)
GTCATAGGCGCCGGCTTGGTCAGATCTTTCACAActgcctcgtcgccgccgtcaagcGCTGGGAATTAACGGGCTTCCTAGCGAAATGGCACGATGGTGT
CGGGTGAGAATGGAGCTGTCCCAAGAAATATGAGACCCGGCTTGGATCTCTTGCGAAGCAGCCGTGGAGACAAAAACGCCAAACCACCTTGAAGTTAACA
CGATTGCGTCGCTGCGAGCAAGACGGCGTCGAACGGATCCCATCGTAGACCATCTCTCTCGCAACTGGATTTAAAGCCTCGAGCTCCCGCGAAGCAGCGT
TGGCTGCCGAGGTGGTTGCTCATGAAGTTCATCAGCAAGCGGCGTCGGTCACTCCGTGTAATTGCCAGTGACGCTCTCCACCAAAAGCTGCAACTCCATT
TTCGGCGGTGGACTTGCAACTTTGTTGGTCACCTCAATTAGGGTAATGCATCCAATCATTTCCCGCTGCAACTTGTACAGTACAAGTGCAACGTGCGCGT
GCTCTGGATGTCGCCAATGAACTTTTTCCCTTCCGCTTTCGCctggtgctgttgctgttgcagcagaagcagatCCGACGCCGGTGGTTTGAAGCCACTA
GCTTCGTGGTCAACTTGGGCATGCCTACTTCATACTACAAACCGTTCAGTCAGCATTTCTGGTTcagttcctgctgcaacCACAGCCTACCGACCGCCAC
GTTCATTGAGGAAGCTGGCCTCGTCCATGACTCGGCATGAACGGACCGTGGATCTGCAGGTTGTAGCTTCCGTGCATGCTTTCCGTGCGGCACCAAGGCA
GTTGGCGCTCTGTTTACTCCATTCTCGAAAAGCTGGACAGCTGGGCAATTCGCCCTCAGTTGCGGTCGAGATATCGTTTCGTGCTGAAAAGTGCGTTAAC
CTCAAGGTACAGTATTTGCACCCTGTTTACTGTCAGTACAGCCAAAAACTAAAATATTCCATGCCACGAGGATCttcgtgtacatgtacatctATCGAAA
CCGATTCGTTTTGCGGATCTTCAGGCTCTACCCACGAAAAACACGTCAAGAGGTTACCGGGTAGGCGCTTAGCGGTCCCTGTGCCACGTGTGATGACCCA
ATAACCTCCACGTCTTTGAGTGCATATGCATAGGAGGTTTGTTGTGCTCGTCGCCTTGACTGCCCTGCGTGTAACACGTAATCTTGTGTACTTTTGTCgt
gcttgaagctggaaaTTGAGGTGCGGTGCGCGCtgtatgtacatgtagtggtGGCATTCCATATCCAGCCTACATAGCGCAGGTTGTGCTGCACAACTAC
ATGCAGTTTAACCTTTTTAGGAGCATTGCAAGCATTCGACAAATGTTCAAATGAAGACTCTTACCTCTCGTTACGCGTGGATAAACAGGTAACCACATTG
TCTCGTCACACAGATAGCTACAAAATGAAAACGCTGGGGCTCAAAATCACCGCCTCAATGACGTATTCGGGAAGCAACGCGCACAACTGGCTGCGACTGC
AGTTACCTCTCCCAAAAAAATGCTAGTACGTTGTAGCTTTTACGGGGACTATTGAGCGGCAACAAAGTAACCTTCTGCCTTTCCTTCTTTCTCAACCGGC
TAAACACTTCAGCGCCCGTTTGGACTCTTACTACTTTGAGTGTGCCGTTTCGTGAAAGCTGCTATTACATGCATTGGGATCTGTCCGACAAACCTCGTGG
ATAGCCCTGTACTTGAGGAATAGTGCAAGTATTGCTCACAAGACGTGCGCTCGCAAGTCTATTGTATGGCACACGCGCAAGCCACGCTATCACAACAGCG
CGCACGACCTGGTCCCTTGCTTCCTGTGAATCCAACGAGCAGACTCGCGTTTATCTTGCTTGCAGTCGCTTACTCCGGCTCGTTGAATGGATggatctcc
agctccttcgcTACAAATGGATTCATGAATTCATGGTGAAACGGGTTCGCTTGGTGAGTCTCCAAGCTCTACTCTACACACCAGTGACGCAACTCTAAAG
CTCAGGAGAAGAAGGTAACTACGTTGCCTTCCCTTGCGTACAGGTGACACACAATCGTGTAGACCATCTTGACAACTCGACTTAAAAAGGAAAATGAGGA
ATTTAAGCGGGGGCTCGGCTAGGGTACCTTCATAGTCAATCTACTACTTAAAAAGTACTAAGTAGATCGTCTTCCACGACTAGATTACGAACAACGGGCG
ATATTGATCATGTGACGAACGAAGCAGCGTTTTATTCGCTGATACGGCGGACAAACAGGTTATTTGGCCTTATCGTAGCCACCTTTTGGCTTGTCTACTA
TCGGTTCGTCATACCATCGCTGCGAAGTGGacgcgttggcgctgcaAGAGCTTGGAAGCTTCTTGGTCACCGCCTCGACGACATACTCTGGAAGCAACCA
GCACAAAAATTGCGGTTGCGGCCATCCCTCCCAAGATAATGGCAGCTGATACGAACAACAGCGACCCCGCCGACGAAGAGATTGAGTTCTGGATAGCAGA
AGTgtccttcgacttcgacgccttGGTGGACATCACACAGGAGTTGAAGTCTGCAACGGTAGACCACCAATACAGTGAGCACAACCACTTCGCTTGGCAC
GCGGCATCCAAACACGATGATTGGAGACGCGACTGGGCCTGCGAGTTGAAGTAGTACTGCTCCAGAAGTTctgcgtccgctgctgctcgctccGCAAAGC
TGGTAATCTCGGATGTGTTCAATGCACTGACCCCGTACTCCGTGCTGGCTTGGAAGAGCGCCTTCCAATCGACATCCTGGGTGGAAGATGAGATGTTCCC
ACCGTAGACCGTGAAGTCGAGAATGTCGTACGTCGTGGCGTCGAAGTCCCAGACCATGAACGCTGGATtgttcaagaagatcggAGAAATTGCCGCCACC
ATGAACAGCGGTACCAGATCTGAGCTGTCTGTGTAGTCATCATCCACAGTCACTCCGTCCTGCTGGAATTGTACACTCAGGCCGCTGGAAAGTGGCAGTC
GGAACTCGATACTGTGCACGTGGCCGAAAAACTGTGCCTTGATGATGTCTGTGAACTGACTGACGATCTGCTTGTACGTCTTGATGTACGTATCGTTCCA
CATGGGGGACCCAGAGTATGAATCGATAATAGGCGGAATGTGGCCAACGATGTAAGCCAACTTGCCAGCACCCCTCAACTCTGACAGCGAGGCGTTCAGC
CACTCGAACTGCTCGAACGGGTCGGGCACCTTTGACGTATCAGGTAAGTGTTGCGGCTGAAAGAGAGCGTACACGACAAAGGGTTAGGTAGAGCGAGAGC
AGAGAAGCTAAATCGAAGGGACTCACCGAGTATGGCAGCGTGTTCAGTGTGATCACGACCAGATTGTCGTCGAGGGCGTACGCTAAGTACCCGCGGCGGT
TGAACCAGTCGAGGTTTGACTTCGACATTGTGTTATTCCATGCGCCGGAGATCAATGCAATGGTCGGGTTCTCCTCCGTCCCAGGGTCCGTCACATTCAT
GGTGTAGTCAGGACCTACACGATTCCACCACAACCGTTAATTCCTCACCACCACACATACTCAAACCCAAGACGCACTTGTGTCGGCGTTGCCAATGATC
GCCGtgacgtccagcaccgtgtcgTTGTCCGCCGTCGAGTAATACTCGGCCATAGTCTCGACGTTCTCCTCGACAGCTTCGGCGAGGTACTCGTCCGACA
GTTCTCCATGCACCGCGTGGTCCCCCGTGTAGAGGAAGAAGTCTGGATCGggcagcaacttcttggCGTAGTCTAGAGCCGACACCAACAAGCTGATCGG
TGCGTCGTCACCATAGGCGATGGGGATCTGggccgagtcgctgtcgttcagGGACTCGGAGATGTTGAGGTGCACGTCCGAAAAGTGCAAAATGTGGCGC
ACAGTCACCCCCGCAGCGTCGTCAGCCccgttgctgtcgctggcatTGCTTGCTGCCGAGTTGTCGACCGCGGCCAAGGTGGTAAAGGCGATTGACGCAC
TTgaagcagttgaagtgacgaTCCCGATCGTCGCCGATGCAAGCCAAACAGCGCAACGCATGGCCACGGACCAACTCGCTTGCTCTCGATGGTGGATTTG
CAGGAATGAAGTCATCTCGACAAGAATCGAGTGAAGCGCATCCGCAatgctggcgtcgtcctaAGATTTACGGCGCAGTAGATGGCTGTGATACAGTGCT
GATCTCGCCCACGTGCCGCTGATGCCACCAGCGTCCGACACACCACCCGTACATGAACTGAAAATACCCTCTCTTAAGTACGAATTATGCGCTTAAGTTC
GATTGTTCTCGCCTCTCAGTGGCTAATAATCCGTCGCAGCGAATTGTTGGCTCtcgctcctcgcgcttgtgTGGGCGATACTGAACGCTCGAGGTTCATT
TCTCAAAGAGGCAAACAGGCAGAGATGGCGAAGGTTACGAGCAACCCCAAGACGGCGGCCGGCAAGTCGGCCGCCAAGCTGTCCAAGAAGGTGATCAAGG
GCTCGCAcggcaaggtgctgaagaTCCGCACCAAGGTGCACTTCTACAAGCCCAAGACCCTGCAGCTGGCCCGCGCCCCGCGCTACGCCCGCAAGGCCGT
GCCGTCGCGCAACATGCTCGACAAGTACCGCATCATCAAGGCCCCGCTCACCACCGAGtcggccat