Description :
From Genome Similarity Track
Location :
Scaffold_657:6043- 7727
Sequence
1684 bases(100 bases per row)
TCAGAAGGTCAAGCGTTTCAAGCATCTACATATTGGACAGGGAGATCTCGTTGAGATCTGGGTGACATACATCAAATACCCTACCAGTACACCCGTGATC
ATGTGACGATTTCCGCACGATCACACCAACCCATCCCCAACACGGTCGAGTTTTCCCTCGACACGAGTAAAACGAGAAGAGTGCAACCCGCCCTACCGGC
GGGTACAAAAGGTGAGGAAGGAATATATCTACACGGTATCGAAGTAACCCCTCCGTTAGTTAGTCGTCTGGGCGCCAGTGGAGAGTTTACATCGCCTCAT
ATAATAAGCGATCGCCACTCCACCACATCTACATCTTACGGCATTGCAAATCTGCATGATATTGCAATTTTACCGTTTATTGTCGTCTCTAAAATAGAGT
CTGCAAGATTAATCTCCGGCGCGCGTTGTGTTCAAAGATTTCTGCCGTACACAGCAATATCGATTCAGATTGCCGCCCAAAAAATTGAACGGTCACCCCA
CAAAGGCGATATGCCCATTCGAACTTGCTTAAACTAGACAAGTGTCGGCTTACCAAGGGTCCGAGGTTCAAAACCAGAGTCAAGTTCAGCGTCTCCCTTA
TATGTGCCGCATTAACTTCAATACGTGCAGGTGTGTTGAAGTCGATCTCACCATATAGCTGGTTTAAATGGCGATCTTTAACTTGCCTCGAATTAAACAT
TACGGAAGGAGTACTCCGATTCTTGCCGTTTGTATAGCCTTGTTCTCACCTTTGCCTTGTCGTTTGGGCGATCCTTAGCTCTTCATTACGGCCCTGAAAT
ATTTCGGTCTCGCTCTGTGTTATGGAACGAGGTTTGGCCACTGTGCAAATATCTTCACACAGCGATCTAGTACTCTTGCATCGATCTCGTTTGCGAATCG
CTCTGATCTTGTTCAGAGATCGGTCTAATCTCGCCAGAAGTGTGAAATACTATTTAAGTTGATTAACGGGATACACCTCGTATATCGCTTCAATATCGCT
CGATCCAGTATTAGAAAACTCTACTCTCTTTCCATAGCCACTTGATGATTATCTCAATCTTGAAATCCAGTCCTTCTTCTTGTATGCTTCGTCTGGTTGC
AGTTGAGGTCTTGTAGATACTTGCGCAATCCAGGCAGAATATCGCGAGGATGGTCTACGCGATCTTAATCGACAATTCATGATAGATCTTCTGTGCCTCG
TGATACATGCAACTTCAGTCGCCGTGAAGCTAAATAAATATTTTCCGGAGAAGGGAGGGGGGCGCGTATCTCGAGCAAACGAAGTATAGTTCATGTCTGT
TCTGTAACCACCCACATTAATCACTTACCTATCATTAAATCCATCTCAAACCGTAGAGAATTCTTCAAGCTGATATCACTTAAAGCTAGACCGCCTCTTG
AACATGTATCGAAATTCCCAGCTTATATCCTTCATGTCAATAATCGCAAGATCATGCTCTTCAATCGAAATAATAGTTAATCTCAAATATTGCGATAGTA
CCAGAATATCAGTTTTATATTTATATGCTTCGAGTATATCTAAATATTAAGCCACAGATGTATAAAATCAACTTTACATCCTCATAAGGACACGTTCTAC
AGGATCTTTTGACCTGAACTTTGGGAATCGTCTCGTAGGTCCTTTCCCAACCTCTCCTTGCCAAGTTACATATTTTATGACCAT