Description :
From Genome Similarity Track
Location :
Scaffold_599:6042- 7249
Sequence
1207 bases(100 bases per row)
CCTCCTCCCTGAGGAAGTATGTGTCACCATTTTTATGGATGGTCTCCGTACTNNNNNNNNNNGTCCATACCTCAGCATTTGAGGAGGCTGTGGACGTAGC
GTTAAACGCCGAGTTTAATTTGAAAGCGTCTCGCAAAGGTAAATATGGGCATGCCCAGAATGTGTTCGACATCGCTGAGCCCATGTATCTCAGTCATGCG
GACGATGAAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGACAGAACCGTACAACCCGTAATACCGCTCCAACTCAGA
CACCCAGTAGGCATGGGGCTCCCTACTGGGGAGGAACTAGGCTGTGTAGAGACTATACGAGGTAGATCTGAACAGGTCTTAGCCCCAAACGATCTCGTGN
NNNNNNNNNTTGGTTGCCTCAGCAACGGTTAAGGTGTTTGAAAATCTGTGGTCAATTCTAATTGACTCTGGGGCATCGGATAACTACGTCCAAAACCGTT
CCCTTAAAGGAGGTCAGCAGTATGNNNNNNNNNNCCTCGGCAAAGGTTAAGGGTTTTGAAAAGCCGTGGTCAATTTTGATTGAATCAGAGGCACCAAGAA
ACTACGTCCGACGCCGTTCCCTTGAAGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCAACTG
GGGCCCGCATCACCGTGCCTAAAGCTCCGTTGGACTTAGGTGTAAAGTTTTAGACTTTGACATCATTGAACGCTGTCNNNNNNNNNNNATATGTGACCTT
ATTCTCGGTATGGTCAGGTTCGAAAGCCACAAGCCATGTATTGGTTACAGGTCAAGGCCTTAGGAACAACGCGCAATGTACCTAGTGAGGATTTAGAGAG
TAATGAACCCATCGTTGCTAGGCAACAAAAGCGCTATTGTCTTGAGCCACTGACTGAGTCAATTAGTGTGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTCTCATTTTTACGACGAACCACAGCATGCTGATAGCATTGATGACCCC
AGGTGGA