Description :
From Genome Similarity Track
Location :
Scaffold_89:60419- 66361
Transcript NameFunction/comments
g6804.t1ETK84049.1 hypothetical protein L915_10935 [Phytophthora parasitica
g6805.t1hypothetical protein
g6806.t1RAW43498.1 hypothetical protein PC110_g354 [Phytophthora cactorum

Sequence
5942 bases(100 bases per row)
GCCAAAGCCAATCGATACCAGCATTATCAACGCAGGCCCAGACTTTAACGAAAACACCACCTCGCCAGGGGCAGGCTCCAGCTCCAGCTCCTCGCACCCA
GCGACAGATGCAGCACCACTCTTTGCAACAGGCAACGCTGCAATCGCAAAGTGAGGCTGAGGTTCTGCAACAGCAGCAGCAGCAACATGGCCTGGAAGAG
ACCAAGGACGCTGGACACAAGGCATTGCAAGCACCGACCCGGAATAGTGTGACCGAGCGGCCAGTAAGTGCCGCTCCGGAATCTATAACGGCAGCAATCA
TGTCCAGGGACAGTAGAACGCATGACAGCGGACTGGTTAAAAACACTGCCGGCAAACGTCCCGCATCGACGGCGCCCGATGGTGCACCGACACAGAGGCG
TCGCGTGTTTCGGGCAGGATCACCCGGGTCTTCAATGCAGCTTCTGGCAGAGTCGGAGGTAGCAAGACGTGCGACTGGGCACGCGTACGAGAGGAATTCG
TTCATGGTGCCTGGTCCTGGAAACAACGCGAAGAAGACAGTACCCAGCGAGCATGACATGGCGATGGAACAGCAGGCCGATAGCTCAGCGCGCTGGCGGC
ACATGCATGACGACGTAAGTCGCGCTCTGAATGCAGCCCCTCGACGACGCCAGCAAGGGCCGGCCTCGTACACGAGCGGGGAACTACGTGCAGCGAAAAC
GCTGGCCAGAACGGAAACGGGAGACCTCGGCAGCAACAACAGCGAGAGGGTAGCCAAGAAGCTTCGGTCGCTTAACGCTGAGTACCACGCCAGCAACATG
CGCCATGCAGATGCGTACAATATGCGGCACTCAGAAACCTTCGACCGCCGCAGTGCTGGCTACAAAGAGTACTGGGGCACGCTTCGTGACGTGTACACTT
CCTCTGGCACCACAAGTGGTGGCTCGGGCAATGCAATATCCCATCGCAAATCGCACCACCGCAGTGGTTCGTCGTCGGTCAAGCAAACAACTCGAGAGGC
AAGCAAGGAGGCAGAGGCTGATTCCACGACCCCGGATGACTCCGGCTCCAGTGAAGATGCCTTTAAGCCGGTGGTCGTCGTTCATGACGCTTCGCTCATC
AACGCCATTGAAAGACTCACGGATGCCACATCCAAGCAGATCGCGAATCTGTATGAGAAAAAAACGTCAGACACGAAGGACACGCTAGCGGGGCTCACCT
CTGTGATGACGGACTTGCGCGTGCAGCATGGCAATGCAATTGGGCGAATCATCGAGCTACAGGAGAAGCACCTGAAGGTCATGGAGAGCATCCTGGAAGT
CAAGTTGCGCAAGGAGGCAGCTCGCAACGGGAAACACAGTTTCTGCTGCAATGACAGCACGACCGCGAGCAGCAGCGGCAGCGGCAGTAGCCCCGACAGC
AGCACAAGCGGCGTCAGTACGTTACCCAACCAAGTTGCGGAGAACCGGCAGCGTGATTGAGATCAACAAGCAGCCAAGCGCATGGAATGTACGCGTTCTT
CCCCGGATAAGTGAGCGATCCGAGCGGCGCAAAGAGAACGAGAGTGAGGTTAATGAGTGATGATATATAAGTCTGCGCAGTCGCGAGCGCAGACATCCAT
ACCTGGTTCTTGAGAGAATGACCGAGTCTTTCGCGTTAAAAGTTCACCACGCCATTTCTAGTGTTGACGTCTGCGACTGCGCTTACGATCGCGACTGCGA
CTGCGACTGGAGCTCGACGAGCGTCTTGTCCGGTGTCGACTGCTCCGTCTCCGACTTCTCGATCGCTCTCTGTCTCTTGATCGCTCTCGACTGCGCCCTA
CACTGCGTTCTCTCCTCGATGGTTCCTCCTTCTTCTCCTTCATCTCCTTCTTCTCTTCCTTCCTCTTGTGCAACTCCGTGAGCTTCTGCCGGATCTGCAC
GTAGCCCATGTGCACTTTGCCGCCGAAATGGTCGGCCAGGCGCCTGTCACTGTCGAAGATGCTGAGGAAGGCGCCGCACACGTCACACACGCGCAGCTTC
TGGTTGACGTCCTGCACATCCCTGCGCTTGAGGCTGTCAGCGTCCTGCGCGTCCTGCGTGTCCTCGTGCAAACGCTTCTGGCCGCGGGCGATCTTCTTCT
CCACGTCGTCCAGCAGCCTTGACAGCTCATTGGCCAAATCTCGCTCGTAGCCGAAGCTGCGCGAGCTCTGCTCGTAGGCGGCGCGCAAATGCGGAATGTG
CAGCAGCTCGCAGGCGCCCACGTCCAGCCGCGTGTTCTGGAACAATTCGCGCGGACACAGACCGCACAGCCAGGGTTTACAAACCTTAGCGTGCTCGAAG
TCGATGGCAGCGTCGTCGGGCCGGTCCCCGTCCCGGTTGAAGCCCATTAGGCGGTCGAGGAGCGCGCGCTGCTCGTCCATGATCTTGCGAAATGTATGCA
GGCACAATGTGGAATCGAAAAAGTGACAGCACCGCACTCGTAATAGTGACATGTACATGTAGCCATTTACTTCAAGTTGAAGTTGATGTAGCCATGTTAC
ACGTTTACCTAAAAGTCAGTGGGTTTCTCCCAGGACGACAGACCAGTCTGCTTGTTGAAGTAGAAGGGTTTGCCGGCGCCATCGTCCCATTGCTCTATCC
ACGGGTTGGGCTGCGGCGCATCGGGGTCGGCTGTCTTGTTTTTCTTGGCCTTTTTGCCTGTGAGCCGGGCCTCTTGGCGCTTGGCCTCTTGCACTTCCTC
CTCCTGCTGCTTGGCGAGCTGCTCCTCCAAGACGCTCTCTTCGTCGCGCATGGCGTTGTCGACGATGGCTGCACCAGCTGCAAGTTTGTCCGCGAGCTCG
TGCGTCTTGGCCAAGATCTTGGCACCGGCGGCGGACTCGGTCACGGTCTGCTTCACCTTGCCGGCCATTCTCTCGACGAGAGTGGTCTGGGGCATCACTG
ATATCATGCCTTTGCCTGTCTTCCAGGCTGCTGGCCATATCTGCTGGAGCTCCACGGGGTAGTTGCTCTGCACGCATACGCGGAATGGACCCTCCATGCC
GCTCACGTAGGCGGCTATCAGCAGAGTGTACGTACGTGCTGCCAGCTCGCATTGTACTCGGACTTCGCGACTGCGGCCGGGAACGCCACTGTGAGCTGCT
ACGTTGTCTTGGTTGAGAGTGGTGACTCGCCTTGCGCGGTCCTTCTGGTCCTTGTGCGCCACGATGTAAACTGCAATAGGTAGCACCGTCACCGGAGCCA
TACCATGCGAGTCCACCTGCGTCACGGTGACGATGACCTCTGTGGGGCGCGATACACGCAGCGAAAAGTGCGGGTTGTTGTCGAGGCCTGTACACCCGGG
GTTATGCCGCGTCGGAAGCCCGCTAGCAGTGGCGTCTTCGCGTGAAAAGCGCGCGTCGATCGTCTTAACGGACCATTTGTCCGGGTCGTAGTAGCGGCAC
ACGTACAACGCGCGGAAGGCGTGGCAGAAGTCATCGAAGCTCATCCAGAACGTGTTATCGTCCCCAGTGTCGCTGCCCTTCCGAACATCCAAACGCTTTC
GCAGGCGGCGTGTCCACAGCCGCGAGGCATCGCTCCAGTCGCCTTTCCATTCCTGGTGGTCTCCTGGTGGATTTCGCAGTTGCAAGAGCTGAGCGCCGTC
TACATCTCGCACGTCGTAGATCACATAGCAGGCATCGAACACCAAGCCGGATGCGCGTAGTGCTGGATCTGCGTGCTCGCTGGGTAGCGAGGCAGCACCG
AGCAAGAAGCGGTTCTTGCGAAACAACTTCAATTGTTGCCACAGCGTCTTCTTCAAAGCCCCTCGAGCTGCTGGCGCCAAGAACACTTCTTCGCACTCGC
ACCCTGAGAGTACTCGCAGTGCATGGTGCACGTAGCCGCCTTGCAGTGCGGCATACCCGCCGTAGTACTTGGCGAACGCCTTCTCAACCAGCGGCACCCA
CAGCTCCTCGAAGTCACGGCTGTGCGCAAATGCTGCCCCAGCGCTCACCGAAAGCTCTGCGTCACCATCAGCGTCCATCCCAGCAGCTTCACGCTCAGCA
GAGTCGTAGAGTACCGGGAAGTAGTCGTCAACGATAACGGTCTCCCATTGACAGTTTTGGTAGAGCCTCAACGCGTAGGCACCAGTGAGTGAAGTTTGCT
TGGTAACAAACAACCGGTCGATGAGCAAATCCACTTTCCCATCGTCAACGCCACCTGAAGCCGCCATAATGCTCAATGCACTCAGCAACCACGCATCATC
CAGACGACCCACGCGCACATCGTCCGGATCTGTGCCACCATCAAACAGGCCTGAAGCAATGTTGATAGCGGACGACACCTTCCACGTCGGCGCGATCTCC
GCTTCCTGTGAACACCCAGCAAGCGACGTCGTGTCTGGAGGGAACTCCCGATCCACGTACTGCAGGGACCGACCGAATTCGCCCGATACGCACGAGTATC
CCGACTCGATCTCCAACAGTGCTTCGCGCGCGTTCTCAAGACCCTCATCGTAACCTGGTCTGCTTTCCTCCTCCTGGGTTAATATGCCTTCGCTCTCGCG
ACGCAGACGGCGAGCTAAAAACTCCTGCATGCGTTGACGGCACTGTTCGGCTTCTCGTGGTGCCCAGTATTCACGCAACTCCTTTTGCGCTACAAGGGCC
GCACGGTCCTCAGCATCTACAATTGTGTCTGTCCGCTCCATTTCTTCGTTGAACGCGGCCTTCAGCGCGTGGAACCTAGCACGGGCGTCTGGAGTGAGTG
AGAGCAGCCAAACGGCCACCAACGGGATGTCGATGGACGCAAAAGAACTCGTGCGGAACACATTGGCCGGAGGACTGATTCCGTTAGACATGAGCTTGAA
GCGGTTCTCTCGTAAGAACTTCTGGAACAAAATCTTCTCCCGGCTCAGGCGTGCATCGGACGCTGTCAGCATCAACAGCTGCAAGTGGATCACACACCGA
GTTTCCTCGTAGAACTCACGGTCCAAAGCTGCGTCTAACTGAGGTAGCTCCAACAGCAGCTCCACTACGTCTCGTGACGGAGATGCTGGTGTCGTATCAA
TTCGGCGATTTGGCTGGAAAACTGTGAGGTCGCTGCTACCTCCTCGTTCAAGGAGATCTGCTTGCATCTCAGCGTCTAGAGTTGACCCATCTTGAGCATT
AGCCTTAGATTTCTTGCACCACCTGAGCGTCGATGGGCAGTACTTCCATCGTATGAACCGAAGTAGGCGTGGAGGAACTGTGAACGCGTACAAGAACCCG
AAGGGCCCCACTCCACGCTGGAAAATATCGTACCTCACTTCTTGCCACGATAGAAGCCCATCCGGTCGAGCCACTTCTAGCCCGTGGATAGTAGTGATGT
ATCGGCATTGACGGTCCACATCCTCGATATCGAGCGCGATGTCACCGCTTGTATGTCGAGGCTCCACCTTTGCAACTTGATCCTCAGCCTTCGGCTCTGC
TGCTTTTGCTCCCTTTTTCCGACTTGCAAACGCACTAGCGGCACCTCCACCATACGCAATGGCCTGGAACTCGAGCTCGGCTTTCTTTTCTCGACGTTCT
TGCTCCACAAATTCGGGTGACTCGAGAGTGAAAGGCTGGCGCCGGCGGTTTGAAACAGCTTGGGCAGCTTCGCTGGCGTCTTTGAGTATCATTTCATTCA
CGTACTTGGCCGCAATTCCCATTTGTACAGGGGTGACGGCGCACAAATGGGCCGTGACGCCAGCAAAAGCCAGCAACACGAGACTGCAGAGACCCACGCC
GAAACCGAGCGGGTCGAAGAACATGACGCCCGCCACCCCCCACAAAAACGCCAATAGAAAGACCATGTAGAGCGGCATGACGTTGTGCGTCTCGTCCACG
ACGTTGTTGGTGAAGGCATTGTACGAGAAAACAGGAAACAGGTACGGCGAGTAGAAGACGGATTCATCGGCTGAGCTCTTGGCCACAATCCAGCCAGCAA
CAAACTGCAGTGAGTTCTTGAGAAGCAGTACGACGAATACAA