Description :
From Genome Similarity Track
Location :
Scaffold_4:604141- 605999
Sequence
1858 bases(100 bases per row)
TTCCCTGACGAGGTGCCCTGCCGACTCTCCGTCGACAAGGGCGTTCAACACGAGATTGACGTCGTGCCCGGCACTAAGTATTGCGTCACGCGGCAATTAC
CGCTGCCTCGCGACCAAGTCGATGCTATCGACGCCTTCTTCGCGGCCCGCAAGGCGGCGGGTCACGTCCGCGACAGCATTTCCTCTCACAGCAGCCCGAC
CTTCTGTGTGATGAAGCCCGGGGGTGAATGGCGTATTGTACATGCCTTTAAAAAATTGAACGCGGCCACGATTCCGGCACAGACGCCGATTCACCGCTAA
GACGTTATTATCGACGACATGGGTCGATCTACCATTTTCTCCACCATCGAACTACGCGATGGTTTTTACCAAATCCTGATACGTCTGTGCGACGTCACTA
CAACGGCAGTTTCCACGCCGAGTGGCATGTTATGGGAGTGGCTGGTCATGCCACAGGGTCGCGGCGACATATGCATGGTCACCGCGAAGTTCCGCCCGTT
TCGCGACTTCGCACCGTCGTACTTTGACGACATTTACGTCCACAGCTGCGCTTCGACCGCACAACCCGATCACGAGGTTCACCGCGGCCACCTCCGCCAG
GTGTTTTAAGTCCTCCGTGTCAACGGACTCTACGTCAACCTCGCCAAATGCATGTTTGGTATTGACGAAATCCCAGTCCTGGGAGATTTGGTGGGGGTGA
AAGGTTGTCGGGCTGATCCCGACGAGATCAAGGCCATTTCGGAGTGGCCTATTCCCTCCTCGGTCAAGGATATTCGTCGCTGGCTGGGCCTTGCAACGTA
CCTCCACAAATACTCGCACAACTTTGCGGACATCGCCCAGCCGTTGTTTCGGCTTCTCGTCAAGGATGCTCCTTGGGTTTGGGATTCCGCTTGTCAGTCG
GCCTTCTAAGGCCTCAAAACCAACCTTTAACGCGCCCCGAACTTGGCGCTCCCGGACTTCGACAAACCTTTTTCCGTCGTCTGCGACGCTTCGCAGTTTG
CCATAGGCTGCTGCCTGATGCAGTTCGACGCCTCCGGTCGCCTCGCCCGGTCTCCTACCAAGGCCGCCAACTTCACGCAGCTGAGCGGGCGTACCCAGTT
CACGATTTGGAACTTCTCTGCATCAAGTGCGCCCTCACCAAGTTCCGAATCTGCCTCCTCGGCGTTAAACCCTTCGTGGTTTACACCGATCATGCGTCCT
TACGCACGGCGACCAACACACGTCACATCTCACAGCGCATGGATCTGGATTTTGTTCTTCTCCGACTTCACCTTTTTGGTCCAGTACAAGCCCGGGAAGG
ACAACATCCTTGCCGACACCCTGTCTCGGCGTCCCGATATCAAACTGACCACGATCGGTCATTTGTCGTCCCGTCTTCACGATCGGATCCGCGCGGCGTA
CCCCCTTGACGCTGATTGCTCGTCGTGCCTGGCGGCGCTCACCGACCCAGTCTCTCCCAAACACCGCCGTTCATCGTTGGCCTTGCATCGCGTTGCCTTG
GCTGATGGGCTTTTGATGTTCTAACCCACCGCGGCCTCGCCCACGCGCATTGTCGTGCCCGGTGACGCGCAACTGCGCCTCACTCTCCTTCGGTCGTACC
ACGACTCCCCCAGTGGCGGCCATTTGGCCGCGACAAAATGCACGCGGTCTTGGCGCGTTCGTACTGGTGGCCCCGCATGTACAAATCCATCGTGCGCTAC
GTCGCTCATTGCGACGCTTGCCAGCGCATTAAGGCCACCACCTCCTCTCGGGCGCCTCTCCAACCCTTGCCTAATCCCGACGAACTTTGGTCGTCCGTCA
GCATGGATTTCATGTTTCGCCTGCCGCGCGACGCCCGCGGCAACACCGGCATCATGGT