Description :
From Genome Similarity Track
Location :
Scaffold_264:6041- 7298
Transcript NameFunction/comments
Aphas_H257_19128AlNc14C11G1380

Sequence
1257 bases(100 bases per row)
GTAGAGCAAACTCGAATGGCCCAACCCACCACAAATTCCACATTTCGTAGATTATCCCCGGAGGGCACCAATCCAAAAACGCAAGGACAATATATCGGGT
ACTACGTAGTACTGTAATGCCATTTCACCGTAGGAAATATATACTAGTATGCTACTGTGAAGAAACGATGTTATTTCGTTGACTGTGAAGACTTTGTTCC
AACCATGCGACTATATTTCGAAATCAAAGACAAGCGTATGTCCGAAATAACGGAGTTTCTGATATATTCTTCAGAATTCATCAATAGACCTCCAGATCAT
AGACTGAAACCTCAACAAGTGACTGAACAGCTAACAAGAACAATTATTTGTTCTTGTAGGGATTATCATGACTGGTTAGACATTCAAGTTATAGAAGCTT
CGTCATTTTTGATAGATCAACTACTAGATTAATATCGGGATCTTCTGGTTAGATCTGAATCATATCCCAGTCACAACATGTTTTTGGAAATCACTCACTG
TATTCCAAGAATACTAATATACTAGTATCTCATAAAACAATAATCAAACTACGAAAAATACATACAGTACGACGAGACTTCAGGTCCGTTGGTTGTCAGT
CGGTATGGTTTACAGCCAACCATGCAATCGAAACCAACACATCACACACAACCTTCCATGAAATATCTCAATGGCTCGTAGAGCTAGCATTCTAGGCTCA
CAGCCCACCCAACTCACGTCACGCGGCATCAGCTAAGCAATCGCTTTGCTTAATAACCTCGAGCAGCAACGCCAGGCTAAACGTGCACGCTGCCCCACGG
TCCGTCCAGAGGAACCTGATGAAGACCCTGACTCTGCAAGCCCTATCTACGACCCAAGCAGCAAACGACATTCACACTATGACCAACTTCAGTCCATCGG
AGTTCAACGTACTCTGGGCCGACGTCCGCACCTACGTCACCAAGCACTGAAACGTCGGCTCAGGACGCAAGTCTGAGGTGTCTGCACGCGATCTGCTGCT
GATGCTCCTGACGTCAATGAAACACTGCGGCTCTAGAGAACGATGAGCTTTCTTAAAGCCATGCATTCTTTCCTCCTCCGCAAATACTACCGTCGGCGAA
AAGTATTCAATGGCGTTGCTCACAACCAGTTGTCACCAAATCGCTAACTTCCCGTTCGTTCGCTACGGAACCGACGTGACGTTTCAACAAACAAATACGC
TGTCGGGCAGTTACGCCGAGAAGAAGACGTACTTCGAAGACGTACTTCAGTGGCAAG