Description :
From Genome Similarity Track
Location :
Scaffold_29:60408- 62465
Transcript NameFunction/comments
Physo_133941Myb-like DNA-binding domain containing protein

Sequence
2057 bases(100 bases per row)
CTGGTCTAGTGAAGGGGCACTGGTCGTTTGAAGAGGATCAAGTGCTCGAGTACCTGGTGACACAGGGCTGCAACAACTGGGGTCAGATCGCAGAGCGTAT
CCCAGGACGCACCCCCAAGCAGTGCCGTGAACGATGGAAGAACCACCTCGACCCGGCGATTAACAAGGGCCCCTACACCGAAGAGGAGGATTCGGTCATC
CTCACTGCGCAGGCACGGCTGGGCAACAAGTGGTCGCAGATTGCTCAGCTCCTAAAGGGCCGCACCGAGGATTCGGTGAAGATCCGCTGGAAGTCCTTGA
AGCAGAACCCCAGCAAGGCAGCGGCCTCGTACGCACAGCACAAGAAGAACCAGCAGCAGGCTCAGGCTGCTGCCGCGCAGCAAGCTGCTATGGGATACAA
CAACCCGGTCCTGATGCGCCAGCGCCAGTTGCAGCTTCTGCAGCAACAGCAACACTTGCAGGCGCACAACACGGAGGCAGTGCAGCAGCTTGACCAGCAG
CAGCAGATGCAGCAAATGCGTCTCCACGAAAAGCTCATGCAGCAGCAGGCGCAGATGCAGCAGGGCCAGCACATTAGCCACGTCGCCATGCTCACCGAAG
ACTTGAAGGCGGAGCCGTACCAGCAGAATCGCGGTATGCTCATGGGTCATTCGCCCGGTGGCGACCCGAACTTGTATGCCGCGGCTGCCTACGCTCAGCA
GCCCTATGCCCCACCGCAGCAGTATGAGGGTCAAGACTACGTCGCCAATAATGGCTATGACCCGCGGTACTATGAACGACAGACTTCCACTGGCGCTGCA
AGCCAAGGCGCGTCTCCGGCGCACCACACCGACCAGCAGCAGCAGCAGAACGGCGGCGAGACTTGGCTCCAGCCTGCTGTCCCCGCCTCGAATGGCGAGA
TCGATCAAGACGGCATGCCGCGGATAGCCGACAACCAGCAACAGCAAGCCCAGCAGCCTCAGCAGCCCGGCGCCAATGGTGCGGGCATGTGGGACCCGTA
TCCGCGACAGGATGCGTCGCAGCTGAGCCCGCTGAGCCTGCAGGTGAGTGAATTTCTTTTCTAAGAAGACCGCCCGCCGCGCCGCGCTCAGCGTCTGGGG
ATGAAGTGATCACGGGCGGCATCGCTTCGTCGGCGCGGCTTGGCTTCGTCCTGAGAGGACGCATCTGAGCTTGACATTGGTTGCTGACAGCCTTCGGCCG
ATCGCATGCGTGTTGCAGGCGTTGTTGCAAGATCCTGCACGAGCTGGCGCGTTGGACCCAAGCTTTTACCAGCCGGTTGAGCACCAGCCGGCGGAGACCG
TCACGTACGAGATGGGCCCCTCGAGCTTCGGCGGCGCGCCGACCATGGCGTTCCCGCACTCACAAGCGCTTTAGCGTGTGAGGACAGAGAGCACCCCGCT
AATTCTCCCGCATAGGTATGTATAAAGGAAGAAAGTATAAAGAAAGTGTCGTTTGCGGGGCTTTGTGGAGGCGTGTTGGCAGTCCGCTGCCAGCTTGAAC
AAGTCGTTCTCGTTGCCGTTGCAGTGGTGCACCCAGGGGTTAATGTTAACCCCGAAATCGGTGGTATTTATACTGAGAATATTACCTGGTCGGAGGATTA
ATATTGTAAATATGTGGTAATACTTCGTTCTCTCAAATGATATTTGTATTTATATTATATTTATATTTACTTAATTTTAATATTTTTCGATATTACCACA
TGATTATGCGTCGCATTGGCCAATCAAACGCCAGTTTTAAAATTTGATTACGTTCTAGAAAAGAGCCCAAGAGGATAAAGCGCATCTTGGGTAATCCAGG
AATATTACACGAAGAACAGTGGAGTAAGAAGAAGTATATGAATACTTCTTCATTAAATGATAACGCTGTGTTTGTATTAGTTTCGGTTAACGCCTGACTA
CGCCTGATGCACATAGCTTCGCCTGCGAAGTTTCAAGTAAATATTATATGATCTATCTTGCGAGACTCACCTGCCTCACATATACGCCGCTGAAGAGCCA
CCAACTTATTCAGCGCTGTAGAACTGTAGCAGTTCGAAGTTAAACCACTCTAAGTCG