Description :
From Genome Similarity Track
Location :
scaffold_81:60403- 61561
Transcript NameFunction/comments
g3005.t1 hypothetical protein PHYSODRAFT_470348

Sequence
1158 bases(100 bases per row)
AAAGAAAAACCACAATGGCAGTAACATTGTCACTGCTACCTCGTGCCAGAGCCTCATGGACTAACACTTGCGCAGCTTGAGAATGCTGGGCGACGGGTAA
GGATCCCACCATATCCACAGCCTCTTGGTCGCTAAGAACATCCCACACACCGTCACATCCCAGTACGAAGAAAGGATAGTCGGCCGCAGGATCTAGTCTG
GAGAAATACACGCAACACGTAAGGAATGACGACATGTCAATGAGATGATGTTCTTACCTTGTCGCGCTGGTGTGTGGTCGTGCAACAACGAACTGTTTGA
GATCCCGATCACCGAAGCTCCTGCAATCAATTCGCTCAGTAATCCACCACCTAACAAGAAAGCGTTGATAGAATGCTACCTGGAAACTGCAAGTACGCCA
GACACGCGATCTTGAATGACAAAGCCGCCCTGTTGGATGATACGCTCCATCTCGTTGTGATCGCTAGCCTTGTGATCCTGCGCATAGTGATTCATCAATT
TGACAGCCTAGAGAAACATACAGAGAACAGTCTACCTTGGAGAGTCTAACTGCGTTCCCGTTGCGGTTGATCACAGCACGACTACGGTATCAAAAACAGT
GTTAACGCAACGTCCTTCATCGCCCTGTAATCGCTATCAACACACCTATCGCCGACATTAGCGACGTAAAGCACCTTGCTGTCCTTCTCCTCCAATAGTA
CCGTCACAACTGCCGTAGCACCAACAGTCCCCGAGAATGATTGACAGCACTCCATGTCTGAGATCAAGAAGCCTCTACACACCAACAACAAACCTGTCAG
CAAGATCATTCAATACCTCGACATTAACGATAGGTGGTACCGTTCAAGACGCTGCTGTACATTACTATCATCATCTGTTAGCTGTAGCTCCGCCGCAATG
TTCTCGTGTAGCACGCGCTGCAGGTACGTCGACACGGAGCGTCCTCCATGCCCGTCGTGGATAGCGAAGTAGCCGTTCTTGTTGTGGTGCAGGAATCCGT
CCACGATTCGGACTGTGTCTTCCATCGTCTTCCGGTGCTCAGCATTCTAACCACATCGCACATATAGTCAGACAATGCACTCGCAGTCATTGTGTAGCGG
ATTGCAGCGCTCGACTCACCATTTCCTCGCAAATGCTCACGCATCGGCAGCAGCTAAA