Description :
From Genome Similarity Track
Location :
Scaffold_5:604025- 605026
Transcript NameFunction/comments
Phyci_89734Hypothetical protein

Sequence
1001 bases(100 bases per row)
GGATACCTTCAAAAATCGGTACCAATTTATCGTTCTTGCGCCACTCATGATACGCGAAGTCCAAAATGTCCTGGGGTACATCGAGAAACACCCCCATAAC
GTACGAGCGGATGTGATCAAGCGGGTATGATAGATGTCCACCCGGCGTCTGCGTGTTGCTCATAAACACCACACCAAGCTGCGCATCGGGGGCGATGCCT
GTCCGCGTTACATGTACAGTGGTGTCACCGCTTTTATCAACGTACGCGTGGCCCCACTGGCCATGGCCAACGTAATCGAAGCCGTAGCCAGATGCGAGTG
TATTGCCGTCGGGATTGTACTGGTGACCTTCGATCAAGAATTCGTCCATGAACTCCTTGTTAACGGTGTATTTTCCCGTGATCATGCTTGTCACCGCGGC
TGGATCTTTCAAAATTGTGACTCCATCCACCGTTCCTTTGTTTAGGATCAGTCGAAGCAGCGTCGCTAGGTCATCCGAGCTCGAAAGCGTGGATCCAGAA
GCAATTTTGTGGCCCTGCCCGTGTCCAGCAAGCTGCGCTTCTGGAGCCTCGACGAGATCGTAAGGTCCGAGGAGATCCTCTCCGCACTGGAAGTGTCCGT
AGCTTGTGTCATTCTCACCCAACGCATCAAAAGCTGAGGCAAACGTACGCGTCATGCCAAGCGGGTCCCAAATACGCTCCTTCAGATAGACATCCCAGGG
TTGTCCACTGACGCTCTTGATAACCTGTCCAAGAATGGCGAAGTTCGAATTGGCGTAGTCGTGGCCACCACGAAGGGTGTGGGCAGGCTCAATATTTGCC
AGACCTGCCACCAGATCCTCATCGGTCGGATAAACCCCGAAAAATCGCCCCACATCCGGTAGATCATTCAGTCCTGAGTTCATAGCGCACAGGTCGCCAA
TGGTGACGTACTCCTCGGCGTACTTGTCGAAGAGTTTGAACGACGGGAGGCGCTTCTTGACCGGATCGCCCCAGGACAACTTTCCTTCCTCAACCTGTTA
C