Description :
From Genome Similarity Track
Location :
Scaffold_2337:604- 3036
Sequence
2432 bases(100 bases per row)
CCAATACCCTGATGTCCGCCTTCCAAGCTAGCGTGATAGTGGTGTAGGACATCCTGTTGTAAGGTTTCCGGCATCACCAGTCTCATCAATCCATCCCGAT
CCTCGTTGACTCTCTTCGTAGGGGGGCAATAGAAGAACAAGTCATTCAGATCCACCGCGTAATCCGTAGCGATAATGCTGTAGGATTTGGCATCTTCCCG
ACTCAGATCCCGTACATCCCCCATCAGATACTTCTTTAGTCCTAGGATCCACGCTTCCTCGTTCTGTGCTTTGAGGATCCGCTCGATGCGGACTCTCTTC
ACAAATGTTTCCTCGAGAATTGGGGGGCTGGATCCAATCCTTCCTCTGGACCTAGTGACGGCCATCGCCTGGACTGTCCTTTTCCCGGACCCCACTACCA
CCACTTCGTCTAGTCGGTTCAACGTAACGAGATCCTGATGCTCGGCCTCTCTCTCCACTTCAATACCACATTGATTCCGTAAAGCGGCGCTGGCCAAGCT
ATCTGCACTGGCATTCCAATCTCGCTTGACATGCACCAACTCGTGATTCATCCAACCGCGCAGGTGGATCATCACTTTCTGCCGTAACAGTGTTAGGGCC
GGGGCCTTGCAGTCAATCTCACCTCGCACCTGTCTGATCACCAAATTTGAATCCCCACAAATCACCAGCCGTTTTGGATCTTGTCCCTTTAGTAGATCCA
AACTCAGCAGTAGCTAGTTATACTCCGCTTCGTTGACGGTGAGGCCTTCCGCATAAGTGGATCTGGCCCGTACAACTTCCCATCCAGGTAGTCTCCACAG
TATTGCACTGTACGCCCCGCCTCCGCGTCGTACGCGAGCGGATCCATCGAAACTCAGGACGTACAGATCCTCGTCTGCCTGTACCGTCCGGATCGGGATC
TGGATCCGGCGTTTGGGCTCTTTCTTAGGAGCAACCCTAGTCAGCGCCTCATCCATCTTAGCTCGAGGTGTGATGCTCGCGGCCAAGACTCCCAGGATCT
CGTCTTCCCCTTTCGAACATTTCACAATCTCCAGCGTCCAAGGCGAGAGTAAAGCTGTCCACTGTCCCAAACGTCCTTGTAACCCGGCCGACTTGAACAG
CCAGGCTAGCGTAGAGTGTCGAGTCAGGATCCGGATGGGTCTTCCCACCAGCAGGTTGTAATTCAGATCCAACACGCGCAGGAGCGCGAGTATCTCTTTC
TCCACCGCTCCGTAGTTCAGTTCATTCGGCTTCAGTGTCCGGCTGACGAAGGTGACTGGATGACAGATCCCCTCATGCTCTTGTACCAGAGCTGCTGAGA
CTGCCCAGTCGCTGGCATAAACTATTACCGTAGGTTGACGTTCTGGATCGAAATGACGGAGGATAGGCGTGGTCGCGATCCTGTTCCTCAGTTCTACGAA
TGCGTGTTGAGCTCGGATCCACCGAGATTCTGCCTTTTCCATGTTCTGATCCGTCGTCTCTACCCAGACTGGATCCTCTCTCCGTTGGTCCCGGGGTGGA
TCCAGCTCCTGTGTTAGGTCCTCTTCTGACGTCATACCACTTGGATCCCTTCGTGGATCCGACATCTCCCGGGCCAGAGCTTGTTGGATTTTCATCCGGA
CAGCTGGAGCGGTCATCGCAGCAAAATCTACCTCTCTTAATTCATACAACACCGCGGCAAACAGGGCGTAATCCTCGATGAACCGACTGTAGTAGTTCAA
ACTGCCCAAGAAGGATTGCATCGCCCGTAACGACTGCGGGAAGGGCAAATCGGCTAACGAAGACAGGTCCTTAGGATTCGCCTCCAATCCCTCCTTGGAA
ACTCGATGGCCTAAGTAATCCACCTTGCGCATCCCCCAATAGCTCTTTACCACACTGATCGAGAGATTCCACTTAGTACACGCCTCCAGTAGGGATGTCA
CTCTTTCGCACAACTGATCCCACGATTTCGCCGGAATTAGAATGTCGTCGATGTAAGATCTGCGTCCTAACACGGACGGGGTTCCAGGATCCCCTGGCTC
TCCTGCCTCAAATGGATCTACTTCCGTATGATCTTCCCCGGATCCACCCCTTTTGGGTTCCGGTATTCGGGGTGATTCCATAGAGAGCGTAATCGATTAG
ACGTTGGTAGATCTGGGGTGCGTTCTTCATTCCAAACGGCATCGGGTTCCACTCGAACAGTCCAAACGGTGTGATGAAATGTGGATATCGCGCGAGCTCG
ATCCGTCATAGTAACTACCCAAAAACCGCAGGCCATGTCAAGAGAGCAGTACCAGAGTACTTTATCCAAATCTTCCAACAGCTCATTGATTAGAGGCAAC
GGATACACCATCAATCGAGTCAGACCGTTAACCAGCCGGTAATCAATGCACAGACGTATATCCACCCCGTTCTTCTTGATGATGATTACCACATGGGGAT
GCCCACGGGGACGTTAAGAAACTGATGATCTT