Description :
From Genome Similarity Track
Location :
Scaffold_2329:604- 2498
Transcript NameFunction/comments
Phyag_g12349mitochondrial-processing peptidase subunit beta

Sequence
1894 bases(100 bases per row)
AGTACACTGTGTACTAGTGCTACTAGTAGCAAAGGAAACCTACACGAACCTAAGAGATCAAAAGTTGGATACTAGTTAAATACTTGTCGAGGAGTAATTC
GCGAAAGCGATGTGCTCTTCATGGTCCACCGTCAAGCGAGTGAAGGCGAGTTGCAGCATGGCTGGATACTGAATTTGCAGCTTGTCAGCAACGGCGTTTT
CCTTCTCTCAGTTCAAACCAGCAAGCCAAATGCACTCAGACCCACGTGCTCACGCGCATTGCTTCGAAGTTGATCGCCTTTTagcgtcgtgctgctcgtg
ttgaagtcacaacgctgccaccaccagaatGAATAGCTTGCACTGAATTCTCCTCAGTAGTATGGATATTCGCTGTAATTTTCAGAAAATATACTCCTCG
CTTCCCATCCCACATCAGCTTTGTTCATTCCGCAGCTTAAATCCAATATGTTCAGTGTTGAAGGGTCGAGAGCAAAAGCAGGTCGCATCTTTGCGCCCGC
TCAACTCTATATTTATGAATTCCGCCCTCTAAAATTCGGAAAACAAACGTGGGGTCTCGAGCGCATACTGGTGGTCTCTCATTCGTAGCCTGGAAGCGCC
CCCAAGAAGCCCTATCAGCACCATGATGTCCAAGTTGAGCCTCGTGCGCCAGCCGCTCACCCGCGCGCAGTCGTCGGTGGCGGCCGCTGTGTCCAACTAC
CCGTCGTACGTGCTGAACGCGCCGGCCACCGAAGTGACGACGCTGCCCAGCGGCCTGCGCGTGGCCTCCGAGGGCTCGCACGGCGAGACGGCCACCGTGG
GCGTGTGGATCGGCGCCGGCTCCCGCTACGAGACGGCGCAGAACAACGGCGCCGCGCACTTCCTGGAGCACATGGCCTTCAAGGGCACGAGCaagcgcac
gcagcagcagctggagctcgagatCGAGAACATGGGCGGCCACTTGAACGCCTACACGAGCCGCGAGCAGACCGTGTACTACGCCAAGgtcttcaagaag
gacgtgcCGCGTGCCATGGACATCCTCAGCGACATCCTGCAGAACtccaagctggacgaggctgcCATCGAGCGTGAGCGCGACGTCATCCTccgcgaga
tggaggaggtcaacaagcagcaggaggaggtcgTGTTCGACCGCCTGCACGAGACCGCCTTCATGGGCAACGGCCTCGGCCGCACCATCCTCGGACCCAT
TGAGAACATCCGCAACCTCAAGAAGTCGGACCTGCAGGACTACATCGCCACGCACTACACGGCCCCGCGCATGGTCATTGCCGGCGCCGGTGCCGTGGAC
CACTcgcagctggtggagctggccCAAAAGTCGTTCGGCGACCTGCCCACGACCCCCGCTGTGGCCCCCACGCTCGAGCCCGTGCGTTTCGTCGGCTCGG
ACGTGCGCGTCAAGGATGACAGCATGCCTCTGGCccacgtcgccatcgccttcGAGGGCTTCAGCTGGACCAGCGAGCACTCGTTCCCGCTGCTGATCAT
GCAGACGCTACTCGGCAGCTGGGACCGCACGTCGGGCGCCGGCATGAACATGTCGTCCAAGCTCGGCCAGGTGGTTgctgagaaggagctcgCTCACTCG
TACATGTCTTTCAACACGTGTTACCAGGACACGGGCCTCTTCGGTGTGTACGCCGTTGGCGACAAGTACAAGCTGAACGACCTGACGTGGTACACCATGG
AGGCGCTGGTGCGTCTTGTGCACAAGaccacggacgaggaggttGAGCGtgccaagacgcagctgaaGGCCAACATGCTGATGCAGCTGGACGGATCGTC
GCCGATCTGCGAGGACATCGGTCGCCAGATGCTGACGTACGGCCGCCGCATGACCCCCGCTGAGATCTTCGCTCGCATTGACGCTgtggacgcc