Description :
From Genome Similarity Track
Location :
Scaffold_1788:604- 1883
Sequence
1279 bases(100 bases per row)
CGGGACGCGCGAGTGCGTGAGGTCGTTGACATAAAATGGATCGAAGCCCGTAAAGGCGTTGTCAGAGTTGTAAAAAGAAAACTCAACAACTTGTAGCATC
GGGCCCAAATGTCTAGACCTCAACAGCACACACGCTGCGAAGAATACATTCAACACCGCGATTTACGTGCTCGTTTGATTACCGGTCTGTGGGTGATCAG
ACGTAGACATTTCCCAGGGTGCCAAGCGCATGGAAGATGAACTTCCAAAAATTACTCGTAAATCAAGGGTATCGATCATCGATATTTGCAGAGGCAGACC
TTGTTGGCGAAACACTCGATCGATAAATAGCTGAGCTGTACCTTCAATTCTATTTATTTCGCCACGGCCTCTGAGTGCAAGATCTTGCTCAAGCGTTCAA
TTAATAACACAAACTCAGTGTTCCAGCGAGACATTTTGGAAGGAAAAATACAAATTTCATTATAATGGAATCTACACACCCCGTGAATACAAGTAGATTC
ACCACTGGCGCAGCAAGATGTGTTAAGAGGTGGAAACGCTGACACGTTCGCACGTGCGAGCATATGTCTTCACCCATTTATAAAGATCGAGCCACCAATA
CCTCTGTTCTACTGAGTTGTAGGGCTTTTCACGAACAAGATGACGCTCAACCCAGTATTACGTACGTACGGAGGATCCGATACTTTGATTTCTGATCATT
ATGAACAAATAATCGGAATATCCTCAGTATACGGGCGATAGCACAAAAGAACTTGACCGGTACTATATCGATGGAGTCTCGCACGCACTCATGCGTGCCT
ACAATTTCTTGTAAAATCTTAAACTCCTAGCTCTCAACAGCATGTACAGAGATACACACTTATCACCACGGACATCAGCCGCATGGATTAAATCCACGAT
GGTTAGCGACAAATTCGCCTCATGAGCAAGCCCGTAACCAGGTCTATGAGACTACGTATCCGTTAAAGAGTTCTACCTGCCTGGCTTATATTTCACTTCG
ACATTATATTCCACAAAGAAGACAGACAACGAGGCATTATCTCATGTAAATGAGGCGACTGTTCCATAGTGTGTAAAGACGCATGTTCAGTGTAGATGAC
AACGGCTTGGGGCCAAGCAGACGCACTGTGAAATTAATTAATCTTACTTCATGGTAACTAGTTCGTTGTCATGAGATCAATAGTTCCAATCAGCAGCTTT
CAGTTGACAAGATTCAAAAGCGATAATAAGCTCACGGCCTTCAGCATCAGCTTGAAACAGAGTGCTGCCGTTAGTAAAA