Description :
From Genome Similarity Track
Location :
Scaffold_1899:604- 1881
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_1899-fgenesh-gene-0.0Serine protease family S10

Sequence
1277 bases(100 bases per row)
GACGACGACGACTTCTTCTGTGGTCTAAAGGACTACGAGGCTGGTTACATCAAGCTCGCGAACAAGAAGGATGACGACTATTTCTATTGGTACATCCAGT
CTTCGAGCGCTGAGCCAAGCAAGGACCCGCTGGTGCTGTGGCTCACGGGTGGACCAGGGGTGCCAAGCACAGTCGCGCTGCTGTCGGAGAATGGTCCGTG
TCTCGTCCAGCCAGACGGCATGACCACGAAGCTCAACCCGTACGCGTGGACAAACGCAGCGAACGTCATTTGGCTCGACCAGCCGACGAACGTGGGCTTC
TCCTATGGTGTGAAGGAAGATGCTGACAGCACCGAAACGAATGTGGGAGAGAACATCTTCTGGTTCTTGGAGGGTTTTTTCGACAAGCACCCAGAGCTGC
AAGATCGAGCGTTCTTCATCACGGGTGAGAGCTACGGAGGTCACTACGTACCCGCAGCGGCTCATTATATCCTCGCGCAAATGAAACAACGGGATTTGAG
CGCCTTCAACGCGTCGACAAAGAGCATCAACCTTAAGGGCATCGCGATCGGGAACGGACTTGTCGACGCCGCAATCCAATTTCCTCGCTACATTGACATG
GCCGACAACGCGTACAACATCACGTTCGTGAATGCAATGCAGCTAGCGAAGATGAAAGAGCTAGCTCCAGAGTGCGAGAAACGAGTTCGCGAATGTCAAG
CCAATCTGGCGCTGTGCGCTGATGCGCAAGAGTTCTGTCAATCCAATCTGGATGAGCCATTCACGAGTGCTTCGCAACGAAACCCGTTTGACATCCGCAA
GTTTTGCATAGCCGGGGACGCTCAAACGTGTAACTCTATGGACCACGTCGCAAACTACCTCAATCTCCCAGACGTTCGGTCCAAGGTTCATGTGAATGAC
GAGAACGTGGGCGTCTGGACGCTAGTCAAAGAGGATGTCCAGTCAACTTTCACAGAAAGCGGGGACGCCATGGTGTCGTACAGTGGCTACGTTGCCGATC
TTCTCAATGACGGTATTCGAGTGCTGGTCTACACTGGGGATGCAGATCTGGCGTGCAATTGGCTCGGCAGCCAGGCCTGGACGAGAGAAATGCAGTGGGA
AGGCAAAGCGGGCTTCAACGCTGCGGAAGAACAGCTTTTTATCACGAATGCTGGGGTGGAAGCTGGCATTTTCCGAACTTTGGACAATCGGTTGACGTTT
CTGCGCGTCTTCAACTCGGGCCACATGGTTCCTCAAGACCAACCCGTGGTCGCGCTTGATATGATCGACAAGTTTTT