Description :
From Genome Similarity Track
Location :
Scaffold_2037:604- 1651
Sequence
1047 bases(100 bases per row)
TGAactgcaagcagcacaaAGCTTTCGTTCGCGTCGGTACCGCTTTTCTTCAATCTCTCCTACTCGATCCATGCCAAGCTGCCGATCAAATGATTGCATT
TCTCGGGGAGGGCCGGGGACAGGTAAAAACCAAGTTATACGAGCCTTGCAAGCTCTCCCTGGGTCTTGGCAGAGCAGCGATGCCATTAAAACTGTCGCTT
ACCAAGGTGTTGCGGCGGAAGCTGCCAATGAACAGACCATCCACAACCTATTCAAACGGAGGGTAGGACGGGGTGCGCACAACAAACGCTACTCTGTCGC
TAACAAAGAGCAATTTGCAAACTCATCATGGATGCGGTCTCGACCACAGACGCCAAGTTTATTGGGATGATAGATATCGCGCTCAGGGAATTCAAAAATG
AGCCCGGTAAACGCTTTGGTGGAAttcacgtccttcttgctggagattggctgcagcagctaccAGTGGCCGGTCATCCCGTGTTCGTCGACCAGCCCAC
GCCTCCTATTtcgcgtgcagcagcttccttGGATCACGCAGATGATGTGACTATTGCGTCAGCGCGGTATCGACGCGTATCGAGAAATCAATGAAGTGGT
GATGTTAGACGTGAACATGCGCCATCGAGAAGATCCCGTGTGGCGTGATATTCTCGCCAGATGGCGGTATGGGGATTACAGACAAGACAACATTGATCTC
GTGAATCGTCAGAGCTTCAACGAAAACTGGCGGGCCGCTTCAGCGATCTCAACAAAATCGTTTTGTCCAATTCTGGTAATCTCAAATGCTCTCCGCGTCG
AATTCAACAAGTTGACAACCCTAGATTACTGCAAGAACGCTGGCCATACACTGCACTTTTTCCCTGCTACTGTTTCTTGACAGCGCGGAGAGCTCACACG
cgggcagcgccgcagcctgGCAAACATTAGGAGCGACAAGACCGGTGATGTTCCCATGGCAATGATGCTTGCGATCGGTTTCCCAGTGCAGTGCACAAAA
AACATATCTTGCGCTCTTCACCTAGCCAACGGAACCATTGGCACCGT