Description :
From Genome Similarity Track
Location :
Scaffold_141:604- 1625
Transcript NameFunction/comments
g10256.t1POM58784.1 hypothetical protein PHPALM_36520 [Phytophthora palmivora var. palmivora

Sequence
1021 bases(100 bases per row)
AGCAACGCCCGAGCGGACAGTGTCACGGCAGGAGCAGATTCGGCGCTCAACCTAAAGCCATAACCCAGACAGCAACGATGTTAATGCATGCTCTGAATTG
CGACGCCACAAAAAATACTTACACGGTCGGCTGCCTGCTGGTAGAGCTGGTACTGGGGTTTGGATTGCTTGCGACGCATTTTGGCCTCCAATTCCGGATC
GATGATGCACTCCTCCAGATACTCCATATATATTGTGAACCACTCGATCAATTCTCGTGAGCGGCCTACTTCCATCATCGCGGCCAATTCGTGCGGATCA
TCTCCTCCCATTTCGTCATCCGAAGCTTCTACACTGATCACACCTTCCTCACCGTCTTCCATGTACTCGACTTCATCATCGTCACAGATAAAATCATCCA
TATCCTCCCCACCATCCGCGTAGACCTTCTCACGGTGGTCCCGCTCCCCCTCTCTCGGAAGCGATCGTCGTTTCTTCTTAAGAGGCGGCGGGGCCTCTTC
CGGCTCCGAGTCGTCTTCTACTTGGTAGTCCTCATCATTTTCATCATCCCCGTCACGCCCTTTAAAATGAGGCCCCAAGCTTTGCAAAGTATCCAGACAA
TTGTCCAGTACGGGGTAGTCCAATTTCCGAGCGATCCCGTGCTGTTTCTCCTTTTCCTGGCGTTTGTGCTGAATCCTCGAGCTGCGCCTCGACGCCGACG
ACGTCTCGTCATCTCCGTCCTCTTGCACCCGCACCTCCTGTTCTTTCTCCAGTTCCTCGTCGCTGTCCTGGATCGCAGGGCGTCGACTCTTGCGTCCGCT
GCTACCACTGCTCCTCACGGAGCCTGCAGATGGCGGTGGGACAATGCGAACATCATCGTCTTCTTCTCCTTCTTCATCTTCTGCATCTTCTTCTCGCTGA
TGGCGTCCACGGTCACCACGAGCCACAGCCGCTGAGATCGAGAGCTGCTGCAGATTCCGACGCGAGCGACGCGTCGGTGTCGGCGTGCGCAGCATCATGG
GCTGCGAAGAGACACCGTCAG