Description :
From Genome Similarity Track
Location :
Scaffold_1316:6039- 8203
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_1316-snap-gene-0.2Gene of unknown function

Sequence
2164 bases(100 bases per row)
NNNNNNNNCGGGTGTTTGAAACTGCAATTGAGAATGATCGCTCGTTGGTGGAGACATCAGCGAGCGGTTTTTATTTGTTTTTATAGTGAAGTGCAAGGCA
ACCATATCCAGTTGGGAAGAACTGCAGTCAACGTACGGTGGCGTCAAGCGCGCAAGGTGCAGGTGGTGGTGAGATCAAATCTCTGCCGGGTCTCCAGTCT
GCGACTGAGGATCAGCGGGCTGTTCACGAGTTTCGTCAGGACCCGCGACGGGTTCAGCTACTGGTGAGGCTTGCGACTTTGCGTCACCACCAGCTTCAGA
CTCTAGTGGAGCCGGCGACTCGATAACGTCAGCACTCGACGTAGACGCTTCGGGCTGCGGGGTGCCACCGGCGGATGGCAAAGCAATAGCGGNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNGGAGCAGCGCCGTCTGGTCCGGTCTCGCGACGCTTAGGCACTGGCATTTCCTCGCTCTTTTCTTCACCAGGGT
CGTCGATACGCTTGCGCTTGGCGATGGGGACCGTTTCAGCCGCGTTGGCATCCGCGTCAGTCGGTTCGGGCGTGGTCGCAGTTGCGCCAGTGACTGGAGT
CGCTGACGAAGTCGAGGTTACTGGAACGGGAGATGGAACTCTCGTCGTGGGCACGGACGCCGTCGCGGTGAGCTCGGCGCCGTCGACAGATGCCGTTTCA
TCTGCTGCTTCTGCGACTTGCAGAAACTTGCCTTGAATGTGATCGGCACGTCCGCACTTGTGGATCGGGTGTTCAGCCTTGTCGATCAGGAAGAAAGCTC
GTTCGGCAGCGACGTCATCAGCGTTGGCAACCGCTTGAGCCGCTGTCTGGCCTTCCTCTGCAAACACTAGGATGACTCCAAACGCAGGCGCCCACGGAAT
GAACGGATCAAGGAAGAGGTCGGCGTCGACGTCCGGCAGAGACATCGCCTACCACAGCAGCGTGAGGACGCCGTTCCACAAGGAGGTGAACTTGGTGTTC
CGGTCGCGACGCTTTGCGAAGAAGATCTGGTAGTCCCTCGGGTTCGAGTTGTCCTTCGGGTCAACCATGAGGTGGTGAGTTCGCTCCCATAGTGCCTGCG
GGTGATGCACCCACAAGTTCAGGATGTTCACGTAGAGCGCACGAAACCGTGGGTCGCGAGGATCGAAGGAGATCGGCTCCGGATGCGTCTCACGGAGGTA
CTGCCAGGGGCGCGTCGCATAGTATTCGGCCGCATCAGCAGCGGTCAGGAAGCGGCCACCCCGAGATTGAGCAAGGAGAGTGTTGTGCGACTGCACATTG
GGTGTCACTCGTTCGTCGTCGAAAAGCTTGAGACGCCACGGCATGTACGCGAGATCGGCTACAGAAGGAGGCGAATCGACAGGCTGTGGAGGACCCTTTG
GCCATACGGCGCTTCCCTTCGGTCGCGCCTTATCCCAGCGGTCGAATGCGGTCCCGGCGCTTAGACGCACCTCGTTGAACGCTGTCTGACCACTTGGTCG
GGCGCGTCCACACGCTGTCGGCGTCATCGTCACAATCAGCTTCTGCGCGGCGTCCGATAGCGCGTGACGCCCGAGGTCATCTTCATCACTGAGGTAGGCG
TCTTCACCTGCCAACGGGACGCTTGAGTTGGGGCGATTGACCGACAAGCGACGGCGACGCGGGGTGCGAGGCGAGCTGGTGTCAGGCGAATACGTCGAGT
CTTCGTCTGAGTCAATGGTCAACACTTCCGAAGGAGCAGGCGCGCCGTCACGACGTGATCGATTCGCTGCGCTCGGCGCATGAGCAGCTTTGCCAGCCTT
GCTGTCCACCTCCAGGAGCCCCATGTAGGTTTCGAGAAGGTTCGCCTCGATCTCGGCCGTCAGTCGCTTGCGAAGGTCCGCTCGGTGGATGTCCGAAAGA
TGCGTCAAGTGCTCCAGCTGCTCGGCACCCGGAAGCGACTCGTCAGGTGACCCATCGTCGCGAGCTTGGAGGTCGGCGTGAAGCTGGTCAAGCGCTTCCC
GAACGGACGCGTACTTCTTCTCGCAGCCGTCGATGTCGGCAAGTGATGCCAATAGGAGCGGTGGAGGCGGACTCTCCACGCCTTGCAACCCGTCCATCAC
GACGCGAAGGATCGCGTCAATCGCGATGGAGCGGCGGCCGAAGCCGAGGAGGAGTGNNNNNNNN