Description :
From Genome Similarity Track
Location :
Scaffold_657:6039- 7732
Sequence
1693 bases(100 bases per row)
GTGGTCAGAAGGTCAAGCGTTTCAAGCATCTACATATTGGACAGGGAGATCTCGTTGAGATCTGGGTGACATACATCAAATACCCTACCAGTACACCCGT
GATCATGTGACGATTTCCGCACGATCACACCAACCCATCCCCAACACGGTCGAGTTTTCCCTCGACACGAGTAAAACGAGAAGAGTGCAACCCGCCCTAC
CGGCGGGTACAAAAGGTGAGGAAGGAATATATCTACACGGTATCGAAGTAACCCCTCCGTTAGTTAGTCGTCTGGGCGCCAGTGGAGAGTTTACATCGCC
TCATATAATAAGCGATCGCCACTCCACCACATCTACATCTTACGGCATTGCAAATCTGCATGATATTGCAATTTTACCGTTTATTGTCGTCTCTAAAATA
GAGTCTGCAAGATTAATCTCCGGCGCGCGTTGTGTTCAAAGATTTCTGCCGTACACAGCAATATCGATTCAGATTGCCGCCCAAAAAATTGAACGGTCAC
CCCACAAAGGCGATATGCCCATTCGAACTTGCTTAAACTAGACAAGTGTCGGCTTACCAAGGGTCCGAGGTTCAAAACCAGAGTCAAGTTCAGCGTCTCC
CTTATATGTGCCGCATTAACTTCAATACGTGCAGGTGTGTTGAAGTCGATCTCACCATATAGCTGGTTTAAATGGCGATCTTTAACTTGCCTCGAATTAA
ACATTACGGAAGGAGTACTCCGATTCTTGCCGTTTGTATAGCCTTGTTCTCACCTTTGCCTTGTCGTTTGGGCGATCCTTAGCTCTTCATTACGGCCCTG
AAATATTTCGGTCTCGCTCTGTGTTATGGAACGAGGTTTGGCCACTGTGCAAATATCTTCACACAGCGATCTAGTACTCTTGCATCGATCTCGTTTGCGA
ATCGCTCTGATCTTGTTCAGAGATCGGTCTAATCTCGCCAGAAGTGTGAAATACTATTTAAGTTGATTAACGGGATACACCTCGTATATCGCTTCAATAT
CGCTCGATCCAGTATTAGAAAACTCTACTCTCTTTCCATAGCCACTTGATGATTATCTCAATCTTGAAATCCAGTCCTTCTTCTTGTATGCTTCGTCTGG
TTGCAGTTGAGGTCTTGTAGATACTTGCGCAATCCAGGCAGAATATCGCGAGGATGGTCTACGCGATCTTAATCGACAATTCATGATAGATCTTCTGTGC
CTCGTGATACATGCAACTTCAGTCGCCGTGAAGCTAAATAAATATTTTCCGGAGAAGGGAGGGGGGCGCGTATCTCGAGCAAACGAAGTATAGTTCATGT
CTGTTCTGTAACCACCCACATTAATCACTTACCTATCATTAAATCCATCTCAAACCGTAGAGAATTCTTCAAGCTGATATCACTTAAAGCTAGACCGCCT
CTTGAACATGTATCGAAATTCCCAGCTTATATCCTTCATGTCAATAATCGCAAGATCATGCTCTTCAATCGAAATAATAGTTAATCTCAAATATTGCGAT
AGTACCAGAATATCAGTTTTATATTTATATGCTTCGAGTATATCTAAATATTAAGCCACAGATGTATAAAATCAACTTTACATCCTCATAAGGACACGTT
CTACAGGATCTTTTGACCTGAACTTTGGGAATCGTCTCGTAGGTCCTTTCCCAACCTCTCCTTGCCAAGTTACATATTTTATGACCATAACAT