Description :
From Genome Similarity Track
Location :
Scaffold_459:6039- 7263
Sequence
1224 bases(100 bases per row)
GAAGATGCANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNGATGAGGATTTAAGTATCGAATCCTCTATAAGGTTCATGATACGCCCGTGGGCGGGCACTTAGGTTGGGAGAAGCTATATGGCTCGGTGAG
CTCGATGTACTGGTGGACCAAGATGTATAAGCGGGTCGGCTCCTATGTACGCACGTGTGAGACGTGTCAACGGACAAAGTCCGCGCCGAGCACGGCAGCG
CCATTGGCGAGTTTGCCTGTCCCCAAGGGATGTTGGCAGTCCATGAGTATGGACTTTGTGTTTGGCCTTCCCAAGGACAAGGCAGGAAACACGGGCATTG
TGGTCTTTGTAGACCGATTGAGCAAGATGGCTCATCTAGCGGCGGTGCCGGACACCATTGATGGTGAGGGTACAGCTTTGCTGTTTTTAGATCGAGTCTT
TCGCCAACATGGCTTGCCTGAGGCAATTGTCTCGGATCGAGACCCGCGCTTCACCGCGAAGTTCTGGACGTCCCTCTTCAGAGTGCTCGGCACTCGTTTG
GACATGTCCACAGCGGACCATCCGCAGACCGATGGTCAAACCGAACGCGTGAATCGCGTTGTGGAGGATATCCTCCGAAGCGTTTGCGCTGCGGCGCCAA
AACGCTGGAGCCAGATGTTCCCACGCGTTGAGCTCGCATTAAATAATGCAGTGCACGCCTTGACAGGCTACACTCCGTTCTATGTGAACGGCTTGGTTAA
CCCTCGCGTCCCACTGACGCCGCCGCGCAGTGGCTCAGGGCTTGATGGGGGAGGGATGGCCGAGCGGCTAGCTGATGTCAGCCCTGTTGCGGTTCGCAAG
CAAGTCGATGACTTTGTCTCTATGAGACTGAGCGTAATGCGTCAAGTGCGCGACGCTATGGCTGAAAGCCAAGACACGCAGAAGGAACATGCAGATGCCA
AGGGCAGAAGCAATGTTGAGAGGTTTGAGGTCGGTGACCAAGTTTTATTAAACGCTAAAAACCTACCTACTCATGCAGTGTCTGCAGTCTTCAAGACGAA
GTTAAGACCTCGGTTCATAGGACCGTTCAAGGTCGTGGCCAGGAAGAGCCTAGCGTATACGCTCAACCTTCCGAAGAAGATGCGCACGCATCCGGTCTTC
TATGTTGGCTTGCTTAAGCCATAC