Description :
From Genome Similarity Track
Location :
Scaffold_152:6038- 7053
Transcript NameFunction/comments
Phymu_g5598conserved hypothetical protein

Sequence
1015 bases(100 bases per row)
CCCTGCACGCTCAGCTTACGCGgttctcgtcgctgccgGACGCCGAGATCGTGGAGCTACTTCGAGTCCTGTCTGAGTTCCTCATCTACTCTGACCAGCA
CCGCGTGTCCGTGGAACTAGAGGATCAGATCACGGAGTCTGAGGACGGCACTGTGCCGGATGACGCtggcgccttcttcgactaCTTCGGAGAGACCAAC
ATGCTCGCTCTGCTCGTGGAATTAGGGGCCAGCCAGCCCTCGGTGCCCGTACAGGTTCAACTACTGCAGACTATGAGCATTCTAGTGCAGAATATCGCCA
CGCGCACTTCGCTCTACTACATTTTAAGCAACAACCACGTCAATCGGCTGCTGGAGTGTCCTTTTGCGGTGGattccgacgacgacgtgcgcGACTGGTA
CGTGACGCTGCTCAAGGCCTTGTCGCTCCGACTCAATGAGGAGACAGTGCAATTCTTCCTGGACACACAACTAGAGGGAGAGGATTTCCGCTTCCCACTG
TACGCGCGGGCGTTGAGGTTCGGTCGATGCAACGAGACGATGGTGAAAGTCGCAGTCAAGACGTTGACGCTCAATGTGCTCAAGGTGCCGGACGCCAGAG
TGCGGAGCTTTGTACTGCAGTACGACGACTTGAACTACTTCCGAGACATTGTGGAGATCGCCAACGACCTCACGCTGAAGCTTCAAGGGCTGTTAAATAG
TTGGCCGTCGGCCGAAGACGCATCGGAGCGGGCAGCTACGACTgagaaactggaggaagcagTGGATGCTTATATTGACCACTGTTTTTACTTACAAGAC
CTGCTGGATGTGAACGTGCCAGAACTCTGCTATAAAATCGGAGACTTGCTGTTCTCTCGACATATCAAGTGCCTACTAGCGACGAGTATTCTTCCAGATT
GTGGACCTCCGCCGCAACGTGTATCGACCCAATTGGCATTGTACCTGCTCACTAGACTTCTGGGCATTTTGGAGCACACGCCGCTCGTCAACGCTATCGC
GTTTATGCTGTTGTC