Description :
From Genome Similarity Track
Location :
Scaffold_28:603721- 604757
Sequence
1036 bases(100 bases per row)
CGGCCCGCTACATTGATTATCTGCGGGTTTGTATATTTTGTGTATGTGCGATATGTGGCCACCTCTGCTGTCTATGCGTTGTGTGATTGCTTGCGTCAAG
GTTAGCATTGCTGCTCTGAAAGGAGGTTAAGCTTTGTGTTTGATGCAGTACTCAAATGTGTATTTCGTGTACTCTGTAACGAGGTTAACTTTGCTGTTCC
ACAAGCTTAGTGTTCAATACGGTGCTACCAATGCATACGTTTAGGTACTGCTTCTTAAGCATGGAATACATCCAGTATTAGCTCTTACTGCTTACTCTGC
GTTACCTTCTGCGACGTTGAGTGAGTTGTCCTCCACAGCCTCGTCCTCGAAGAAGCGCTTGCGAACAAGAAGGTGGCGCTACTTTTCGAAGGCAGCAACA
ACAGACTTGTGAATGCGCTCCCTCGTCTCCCACGTTGGCTGCCAGTCTACGAGGTAGTACGCCTGTCTCTTCTCGCCGCCTACGTGATCGTCGTCAGCAT
CAGATGGAGGAGGCTCGACACACCATTCGCGAACATCGTCAAGTACCGCCCGTCGCTTCTTCCGCTTCTTTATGGCTTCGTAGATGACTTGGATAGTTTC
GGGAAGAAGGCTTGCTGATGCGACGATCGCGTTCAAGGTAAGTCGGAGGTGGAAAATCGCTTCATCATCCAGGCGAAGCTTATACGCCTTGTCTGGTGTG
ATACACTGGGTCTTGAACTCTTTCCAAGAGCTAACGGGGGGTTTGGTCAGCTTGATCGCTGACATGATGAGCAGTGTGACGGTAAGGTGGGGTGTAAATT
GCAGAATGATTTCAATATTAAGCAACGTGGTAGGAAACGACTGGACCAGGCAAGTAGCGTGTCATTACTGGACGCAATCTAACGCTATGACTTCGAATGC
AAAGGTGCAGGGTCGGTGATGCGTCCCGCAGCGTGAAGTTGGTGGTAGCTACGGCTATGATCGTTGAGAAGGCCGCTCTTGTGGAGCTGGCGCAGGACTT
CAAGACATTTTGGGCTCCACGAGCGGTGATCTTGTG