Description :
From Genome Similarity Track
Location :
Scaffold_1669:6037- 7223
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_1669-fgenesh-gene-0.1Sodium/hydrogen exchanger

Sequence
1186 bases(100 bases per row)
GCTTCGGGGTCTGTCTTGTCGCGCGAGCGCTCCTCGTTTTCCCGATCTGCTATCTCGCGAGCATGTGGCGACAGCGTCCTATCCCGTTTAAGTACATGGT
CGTGATCTGGTTCTCGGGGCTTCGCGGCGCCATCGCGTTCGCACTGTCGCTGAATGTCAAGAATATCAGCCATTCGAACCACGCCGCGATTATCCGCAGC
TCGACGATCTTCACAATTCTGACGACGACAATTGTAAGTGTGGCTCGTTGATCGCGAAACTGGATAGAGTTTTCATTGTCGATGTGGATGCCTTTCGTCT
GTAGCTGTTCACGATGGCAACGCGGCCGCTAGTGAAGTTGCTGGGCCTGGCTCACACTTGCCACGAACATGCCCACGAACGCCTCCACTTGGCATGCGGT
GGCCCAAAAAGGCGAGTGTGTGCATGCTTCCGTATCATTTCTTGTGATAACAATTGCTGATACGTGTGACCATGTACATTTGTGGATCTTCAGGACGTCC
GAGTGCTCTCCGTTGTTGTCAGCGAGCTCCGAGCAAGAGGCGACATGGATTCAAGACACCTGGAACGACTTTGACGAGCGCCACTTGCAGCCGCACTTTG
GCGGCAGCACCTCGCCGCACCCAGCAGCCACCACTTCGAGCAGCGAGAAGGCATAATCTTGGAGCTTGCAGTTGCTGGCGCTTCCAGTGTCGGCGCCATG
TTCTGCAAGCTGTCATGAACTGGAAATGGCATCTTGTATGCAAGCGAGAACACAAAATGTCTGGTATGATGGAGCGTATGGTGCAACTGGCCGATACAGC
GAAAGGATATGAATTAAAGGTATGCGCTGCTTGCTGTCGAAGCTACACTGTCCGTCAATGTAACTCAAGAGGACACGAACCAGAACATTTACGTACGATA
CATGCAATAGCCCTGTGCATTGCTGACCCTTCCAGCGACATCAGCGGTCTTTCGTGGAGGTTCTTGGTGAGTTGCAACCGACGCACGTGGCATTCGTTCA
CTCGGTCGAGCCACGTTGCTTCTGCCGCCACTTGTGCTCGGTCTCGAGCGCGGCCCAGAGCCTGTCCACTCGCACCTGGATGCGCGCGATATCCTCTGGT
GATCGTACCGGCGGCTTGAGCTTTCGCCGCTTGCGCTCGCGGCCGATCGACTTCGTGAGTGTGTCGAGTCTCACGTCCGTTATCAC