Description :
From Genome Similarity Track
Location :
Scaffold_32:6036- 7209
Sequence
1173 bases(100 bases per row)
GACTACACGTTTACCAAAAGATTGGAAGTATGGCATTTGGTAATAATTTGGGTAACGCCAATTGCTCGCGGTATTTTCGTAATAATTTTGCGGAGCGCAC
TGTCTGTCGCCTTGTTTGTACCTTCTTAGATAATGTAAGTCTTCTTCGTCCCTTGTTCTGTTAAAATTAACTTTAAGACGATTTTTAACTTTTCAGGGTC
TCGAATTTTAGCAATAATTCTTTCCGTAACATAAGTGGATCATTTCGGTAAACAATTTAGAATCGATCGACGAAGTTTACAAAGCAATGCTCAGCTTAGC
TCACCAGCTAAACGTCGCTATCATACCCCGCAATATACACAGTTCGAAAATGGGGGAGACTTCATTTGACAAAACTTTCATCCATGTAGACTTAGACGAG
GTCCTATACCCCAAAAAAGCCTTCTTCTCGTTACGGCTTGGACAGTTTTCTTTGAGCTGCAATTGTACTGCTTCGCATTGCTTCTGTCTTTACCACTGCG
ATTCTCTCCGCAAGCGAAACCGCGCATTCCTCAACAGCATACATTCGATCGATTCTGGTTGTAATCTTTAGTAAGTGTCATCAAATGAAGTTGTTCAATT
TGTTAAGGATCCATCATCTGGACGGATGTGCGAGCGTGGGCTCGCTAATTGTAATTTTCATATCGGTGTTTATTCAGAGAGTGACCAAAAAGCTTCATCA
ATCATGATATTAAGCTCTGCGACATGCCTGTTTCTCACTTACAATGTCGAATGAAGTGGTAGAACATTGCGTAAAGTTTAGACGAATATACCGTGGAAAC
TTTACATTGTTATGCCTAGTAGAGAATACCTTGAATCAATAAACCCTAATGTCAGATTTTAGACTTCTTCGACGTAGACATAAAAATGCCGGAATTGGTC
GGAATTTCGTAATAGCCTCGTATTTTGCTTGCAGCACTAGCTCGACCATGTACTCCACAACCTGCGGTGTTCGCAAAGTCGATGCAAGCAAAATTATCCG
TCAGATACAGCTCAAGCAGGACCTAACGTATAAATCGGGTGCCCAAATTATGTTTCAGCTACTGCAGAGCAGCGAGAAGTGATATGCTGGATGGTAATTT
TCTGCCACTCAAAATGATCACCAATGGAGAGACGGTTGCCGCATGACAAAAACAGCACGTCGAGCGCTCGGTG