Description :
From Genome Similarity Track
Location :
Scaffold_624:6036- 7167
Transcript NameFunction/comments
Hyaar_Emoy2814383hypothetical protein

Sequence
1131 bases(100 bases per row)
GTGGTTCGGTCTTGATTGTTTTAACTCAATCGCGCAGATGTGACGCCCTTCTTGGGCCTAGATGCATCCTCTGAATACCGATCGAATTGTCAGAATCGAT
TTCGGATTCAGCTGATGCGTACTGCGAAGATCCAGTGAGATATCTTCTCGAGGCGTCTGCGATCGCTGTGTCCGCTTGATCCGTACGATCAGACTTGCCT
GTCAGGGGAATTAACTTTTCGTATAGCGATCAATACACTTGGGCCACCTGATCTTGATCGCACTCCAGCAATTTGTTCGCGTCGAACACTCCGGTGACAA
AACCAGCTTCATGTAGCAGCCGCATCATCCCGTTGACCTTGTCCAGCGTATTAGACGCTCCTGCCGGTGGGGGGTATAGGGCCTTGAATCTCTCCAATCA
GATTGGGCTTAAGAATCTGGATCACTGGGTCGCTTGATAGCAGATTATTGAGTGTATTCCAGTGATATCCCTTCGCCAACTGATCTAGCTGCCAGCCATC
CATCTTCATATTGGGGTCCACGAAATGGATCGGGCTATGGATCGAATTCAAGCCGCGATCGTGCTGATCCGATCTGGACGCTTCTTTCTTCACTCGTGCT
GTCTTCATTCTTCGTCTTTGACTTTTCTTGAGTGGTCTTGAGTGATAACTGTTCGGTTTTATCCGAAGGTTTTCACCCAGCAGATCGTGCTTTGCGGCGC
GATCCGCGGTGTTCCCCGAAGGGACCTCAGGAGGGGGTCGAGTTTTTTCTTCCATATCGATCGATCGATCTTCCTCTTTAATTTTCTTGTCAGCAGAGCC
CCTCCTAAGACTCCGATAATCTGGCGATCCTTTAAAATCACGCGTCGGCGGCGATACCTCTGCATCTGACGCTTCCATCCCAGGTTCCGTCTTTATTTTC
ACCTCTTCCCTCCAAGACTCACGGTGAAATCCCGAGCCACCGGTAGATCCGGGCACGCGGACCATAGTGGTGGAGTGACGATCGCTTATTATATGAGGCG
ATGTAAACTCTCCACTGGCGCCCAGACGACTAACTAACGGAGGGGGTACTTCGATACCGTGTAGATATATTCCTTCCTTACCTTTTGTACCCGCCGGTAG
GGCGGGTTGCACTCTTCCCGGTTTACTCGTG