Description :
From Genome Similarity Track
Location :
Scaffold_1122:6030- 8725
Transcript NameFunction/comments
Phyag_g9573hypothetical protein PHYSODRAFT_552333

Sequence
2695 bases(100 bases per row)
CTTCAGGCCGTTCACGTACAGCGTTGGGTACTGCATCAGCACTGCAGGAGACACATCCTGGTTGTACATTGCAATGATCACGATTGGGATCGTCGTGAAC
AGCGCGTTGTACAGCGTGAAGAAAATGCTGAAGTACATCAGCAAACCACTGTACAttgtctccatcgccaagtAGAAGTTAGACATCGACAGTGCCACAT
TCTTCATAAACGAAAACAGGATAAGCTTGGAAATCCTCTTGTAGCTGTAGTTGCCGTGCACCAAAAGGAGTCGTTTCAAATACTGGAACTCTGCGATGGA
ATAGTCACTGGACAAAACAGCTTGACGGCCCTCCTTGCCACTGATACCGACACCCACATTTGCAGCCTGAATCATCGGTACATCATTGGCACCATCACCA
ATGGCAAGGGTAATATTACCTGGGGAGAACATGAGCGTGGGTTCTGTAACAAGCTTCACCACTGATGCCTTTTGAGCgggcgagcagcggcagcaaatAA
CAGACTTGCACTGCGTAGCCACTGCCAAGAAAAGGTACTTGATGTCATCATCAAGCACCAGCGCAAGCGTTTTGCCATCGATCACCATGGCAAACTCCAA
TTCCTCATCCACGTATTCGCCACTGCTCATGCTGCCAGTGCCACCCATCATTGCTTCCGTTTTTGGCTCGAAGTCGTGATCGCACAAGTCCCGGTCAAAG
CTGTTCTCAGATAGTTCACGGTTCGGCATGGCCGGATACACCTCATCGTAGTGATTTACGGGGCTATCTGTCGGCGtgtcagctccagcaccagcgtgcT
CGCGGCGTGGCAGACGCCTCCGTTTCTTTCTGGcctcagcttcttcgtcacgTCCCACTAGAGCCAGCTTTACAAGATCCCACAGGTACAAAATCGCTCG
CTTCAAAGCTTCCCACAACACACTAACCGCCGACGAGGTTTCATCAGATCCCCACTTGTCCTCTACCAGGTCGACGTATAGCTCCTCCAGTCTTGTACGC
AAGGAACCCTTGTCACGCTGTCCCAACACGATCACATCCATGTTGTCATCAATCACATGCGACGACATGCCAATGCTGAGAGCAGTTTCCTTTTTGTCAC
CCGTGAGCACCCAAAACTTAATACCGGCTTTGCGTAGGGCACAAATCGATTCTTCCACGCCATCCTGAAGTCGATCTTCAATGGCTGTCGCGCCGAGCAG
TGTCAGCTCAACCTCAATGATGGCAGAAACCTTGGCAATCTTTGCAGCACGCCCCTCCATAGAAAATTCTGCCTGCCGGTACAATTGGTTCCACTGATCA
TATTCTTCTTGCGTAAGGCGGCGCATAGCTGTCGTCAACGTTCGAAGGCCTTCTGATGCATATTCCTGGAGGTGACCACGCGTCACGTGCGCCACACCCT
GAGGCTGGGATTTCGAGAGCAGATCAAAAATTACGTCATCGGCACCCTTGCAGTACAGTACGATACTCCCGTCAGGGAATCGTACGATCACTGACATACG
TTTCCGGTCGCTGTTAAACTCGAGCACGTTCAGAATTTCAAACGACATGGGTCTGCCCTGGATGACTGCGTTGCAGACTGGGCCGTCTCGTGAATCCAGC
ACGTAGCcgagatcagcagcagccaataCCAACGCCTCTTCATCGGGGGAAGACGCGTTGTACTTGATCGTCGGAGTTTCAGCCGAGCAGGAACCACTAC
TCGAAGTGGGTGGCGATGTGGGGACGTTGGTCTCCGGGATCACAGTGTTGCAAATCGTGAGCAGCAATAAGAAATCGTGGATTTCCTTCTTGGTTGAGTG
GTTTGAGTTCAGTCGCGCCAGCAATCGACCGTCATTAAACCGGGTGCCAGGTCTTGGAGGCTTGGCGGGGTCCACTTCGATGTCGTTGTAGCGGAGACCG
CCGATGGTGCACTTGGCAAAAATCATTTCGTTGCATGTGAGCGTGCCTGTCTTGTCTGAGAAAATGTACTGAATCTGTCCGAGATCTTCGTTGATGTTGC
TATTCCGAACTTGCGCTGGCGTATTTGTCTTGGCGTCATACATCTCCAAATCGTTTTCGATGTAACGCGCGTGAACAAAACGCACGCCCTCCATCGTCAC
GTACATCGAGAGCGGAATCAAATTGTTAAACAGGATCACGTAACTCAAGAAGATGTAGCCGTTCGAGTCTTCCTGAATATACCATGGAGTCCTCTCATCT
GCCAAGTCCAAATTCCAGTTGTTGTTGCCTAGCGTGCAGGCAATCGAAATTCCGAAAAGCAGCATCAGAACCAGCACGAACATCGTATCCAACGTCTTCT
CGACAAAGCTACGCTTCAGCGGCACGGCAACTGAGTTCATCTGGACCTTGGTCGATTTACCCGTGTAAATCACAAGCCCCAGCGTCCACTCGGCATTTCG
GCTTTCACTGCCACGCAAGATCAAATTATCCATCGTCAAACTGGTCTCGTTGTCCTCCTTGGTGGTATCCGTAACAGCGTCATCGGCAATCTTTCCCAAT
CTTAAAACTCCGTCAAAGTAAAACAGATCCTTGTTGGGCACATCGCACTCCACCTCAAGTGTATGCCGTTCCAAGATTTCTTCAGCAGTCAGAAAATgct
tcgtgcagctcgcaaCCTGGCGGATCTTCAGGTTCGTCTCGCCATCCAAATTGGCAGTCTCCACATAGCACCGGCCATCAGGTCGGCTCGTAGCC