Description :
From Genome Similarity Track
Location :
Scaffold_32:6028- 9079
Transcript NameFunction/comments
Hyaar_Emoy2804803hypothetical protein

Sequence
3051 bases(100 bases per row)
ATCATGAGGACTACACGTTTACCAAAAGATTGGAAGTATGGCATTTGGTAATAATTTGGGTAACGCCAATTGCTCGCGGTATTTTCGTAATAATTTTGCG
GAGCGCACTGTCTGTCGCCTTGTTTGTACCTTCTTAGATAATGTAAGTCTTCTTCGTCCCTTGTTCTGTTAAAATTAACTTTAAGACGATTTTTAACTTT
TCAGGGTCTCGAATTTTAGCAATAATTCTTTCCGTAACATAAGTGGATCATTTCGGTAAACAATTTAGAATCGATCGACGAAGTTTACAAAGCAATGCTC
AGCTTAGCTCACCAGCTAAACGTCGCTATCATACCCCGCAATATACACAGTTCGAAAATGGGGGAGACTTCATTTGACAAAACTTTCATCCATGTAGACT
TAGACGAGGTCCTATACCCCAAAAAAGCCTTCTTCTCGTTACGGCTTGGACAGTTTTCTTTGAGCTGCAATTGTACTGCTTCGCATTGCTTCTGTCTTTA
CCACTGCGATTCTCTCCGCAAGCGAAACCGCGCATTCCTCAACAGCATACATTCGATCGATTCTGGTTGTAATCTTTAGTAAGTGTCATCAAATGAAGTT
GTTCAATTTGTTAAGGATCCATCATCTGGACGGATGTGCGAGCGTGGGCTCGCTAATTGTAATTTTCATATCGGTGTTTATTCAGAGAGTGACCAAAAAG
CTTCATCAATCATGATATTAAGCTCTGCGACATGCCTGTTTCTCACTTACAATGTCGAATGAAGTGGTAGAACATTGCGTAAAGTTTAGACGAATATACC
GTGGAAACTTTACATTGTTATGCCTAGTAGAGAATACCTTGAATCAATAAACCCTAATGTCAGATTTTAGACTTCTTCGACGTAGACATAAAAATGCCGG
AATTGGTCGGAATTTCGTAATAGCCTCGTATTTTGCTTGCAGCACTAGCTCGACCATGTACTCCACAACCTGCGGTGTTCGCAAAGTCGATGCAAGCAAA
ATTATCCGTCAGATACAGCTCAAGCAGGACCTAACGTATAAATCGGGTGCCCAAATTATGTTTCAGCTACTGCAGAGCAGCGAGAAGTGATATGCTGGAT
GGTAATTTTCTGCCACTCAAAATGATCACCAATGGAGAGACGGTTGCCGCATGACAAAAACAGCACGTCGAGCGCTCGGTGGAAGCTCGTAAATTGACGT
AGCATCTGTATTGTGCGTTCCCGTAGTTTTTATTGCTTTTTACAACTACTAACGACCACCTCTGTAGATATTGCATTATGTTCGTTCACAAGTCAGACAA
GATCCTTTTAACGCTAATTTTTGACAAGCCAGCCTCTCGCACAGCTTTGGTGTTATACAAAATTATACCTATCAAATGGGAGCCGAAAGATCCGAGGCGA
ATCGAGAGAGTGAGTGATTTTCTGGATTTGGGACCTTAGGGCCGACACTGCGTCGCTTCGCGATTTAAAGGACTCTGCAATTGTCCAGTAAAGATGATGC
GGTATATGTTCAGTAATTTCCCCAAATTTACTTTGCCGCATTGTCATCACACAACACCCCAGCGCTTTCGCCGCGATTATGCCGATTCTCTTCGTACAGT
CGAGAGCAATTTGCCTCCTCGAGTGCTTTCACGCAAGGATTTTCACCAAACTTCGGGTTGAGCCTATTTTTCACCATGCCACTGGCTATAGAAGCGGGTA
CAAAGGCGCAGATATACCGCATAAGAGTTAGCATAAGTAACACCATTTGAAAAGATATGTTTGTGATCGCTGAGCTTGAATGAAAATTTACGAATGCTAA
AATGATCGCTGAGCTTCATAGACATATCTTTTCAAATGGTGTTACTTATGCTTTGTTTTAGTCCGACAAAACTCGATGATGGCCGCGGACCTCATGTGTC
GAAGCGAGCGATATGCACGAGCATTGCTTCTTGCTTGCATAAAAGCCTGTGCATGTTATCAATACGTCAGGATCGCCGGGTACAAATATACCGCTCATCT
TAAGTTTCTCGACCGCTCACTATATGCTCCTAGACAACATTGGTCGATCATGTTAGCGCTCATACATGCTCTTGTCGGTCAATCATCAACTTCACATGTG
AAAATGCGTAAAAGCGCTTCTGCATCCACCACAAGGCGATATCAACTCCCGAACCTGAATGCGGTGCACGCACGTTCATCTTCATGTCGCAGCCGCAACT
TCACCCAGCACACTTTGTGTAATACAAACTTTTTTAGGAGAAGTAAGACTGAAGGTCATCGGTCCAGCCCATGCCAAAAATATAGCCAAGGTCAAAGCGA
CTAAGCATTTTCAAAAGCAATGTGAGCGATACTCGCTGACCTGTGGGGTGTCAAGACATTCCTTCGACCCTTTATTTTAGTGGCAATGACGTTTGGGCTT
GCACGTGCGCCATTATTCGCATTGTCTACGTCCAAAACAGCACATTTTTACCATCAAAAGTTGTATAAAAAGGGTATTGCTAAATACACCCTACTTTTTA
CTAAATACACCCCACATACACCACCCATACCACACCACAATATGGTTTGTACGACAAACATCGCGCCACTATACCTCTGTACGACCACGATCGCACAGCA
TTCTGCATCCATCGTACAAATGTTAAGTGATTTTCCAAGTAAATTTCTATTAGCTTGCAGCCGACGACTGTAGCTCTTTCCTTTCGTAAATGATTTGATC
GACGACCACGACGCACTCATCACTACATGCCAAATACATCTGGGGCGCTATTTGTATCGTTTTAAAATGGCAACAGCCAGGTTTCAGTCGGGAAAGGTAC
AAAATGATTGAAACAAAGGCTCACGTGTCACGAATGTAATCGGATGCATCCGTTGCAGCGAAGGTCACCACTACCAGTGAAAGACAGATTGATTGATAAA
TCACTTAACCTTTGTACGATAGATGCCGATCGTTGTGCAATAGTGGCCGAACAGAGGTATGGTGGCGCGATGTTTGCCGTACAAACCATATTGTGGTGTG
GTATGGGTTTGGTGTATGGGGTGTATCTAGTAAAAAGTGGGGTGTATTCAA