Description :
From Genome Similarity Track
Location :
Scaffold_576:6027- 9202
Sequence
3175 bases(100 bases per row)
CCCGTTACACCCGGTAGCACTTCGTAGTCCGTTCAACGACAATGAACGTGTGATGACGTATCGGAAGACTTCCATCCAACGCACAAGAGCTACTCCCATT
CGAGTTAAATTGAATGAGATGCCGTCAAACGGTTGATCTCAACGATAGGGATAGAACCCGTAGGCGCAATGCCGTCAGCTCTGGGTCCAGACGGACAACG
CGCCACCATCGCTAAGCTTATTCATGATGAGCTTGAAGCTGAATGTAAATCGGTAGCCTTGTATCGCCAACAAGGGTCTCACCAAATAGATCTGTTGAGA
CAGCAGCAGACTGCTGCTACCGAGTCGAAATACACACGTCGACTCGAATCGCTGTAGATGTACATCTTCAAGTACAGAAGAGCTGATGAAGACTCTCTGT
TGAGATGGTTTGCTGAACTAGATGACGCCATAAGGGCTAGCCATATCGTCGATGAGCAAATTCAGATCCCATTTACTCAATCGAACGTGGCATGACGTGC
NAAGACGTGAGCCTTGGGCCTTAAGTTACACGACCCATATGTCTTGGGTCGTTAAAGTCTTCAAATCCCTGCTTAGGTATACATTGAATTGCCGCAAGCT
GAGTTCAGGTCTCTCTATGAACTCTTGAAAGCTTAACAGGGACAACGTGATGGACACTCATACATTCAGTACATAAGTCAACTTACGAGTTGCATTACAG
CCAATCCGGCGAATGGACCAACGTTGAATACGTTGGTCATGCAAGGTCTCGCGGATGGTCCAGTCAGGGACTACCTCTTCCGACGGAATTCGATTTTTTT
ACCTAAAGTGGCATCCGTGTGGCGGAACAGGAAATATCATCGCGAAACAAGCTCAAGTGAATTCGAATGCCTATCTTCTCCCTCCGAGGCGACAGGAAAA
TGGAGGCCCAGAAACAATGGACCTCTGTAACGCGAGGAGCAAGAGCTCTCGTGTTAACAACTACAAGAAATTGCAAAAATGCAATAGACATCAGAAGACA
TGGCATTATGCATATGAATGCAGTGCCCCGAGCGCGGTACCACGTACCGCAGGAAACAGTAACCTCCAAGCGGCCAAACGAGGTCCAAGGCGTGGTTCGA
CGTTGTTGCGAAAATGCAACAACGTATCGGACGGCCAATAAACGGTCCGGGTCAGTAGGTGCGGATCACCTTACTGATCCAGCAACGTCAAGTGAGTTTA
CAGGCCTCTTGACGAAATTCGCTCCCAACACTCAGTCATTGTGTGTTGCTGCTTCGGGTAATGAGGTTTCTCTCATTACCTTAAAACTCGAAGTGACACA
AAGCATGCCGCTTTGAGCCCTAGTCGATTATGGGGCGTCGAACAACTTTGTACGACGCCAATCGCTAGGCAAAAGAGAGCTCGAATATATCGAGCGCGAG
ATCCCGCCAACGAGGATGACGGTGCGCCTTGCGTCAGGCGCATCCGTAATAGTGATGAAACGTGTAGTGGGTATTACTTATACACTGAAGAGAGTCCAAT
ATAATGATGACTTCATCATATTAGACTTGGATGACAAGTTTGATGTCATCCTTGGACTACCGTGGCTCAGAAGGTACGAGCCACAAGTCAGCTGGCATCG
ACGAACAGTTGATGCCTGTCACTTAATCATCATATGGCCATAGAGCGCCCACTAAAATGTGGGTGTACTACGAGCGAGTGCGATGGCCTCGCGTGTGGTT
CAGTCGTTAGTACGACTGCACATGGCCATGGTGTGGCTGATCGCCACACCATGAAGCCAGATTCCGGCGACTGCAGTGAGATGCAGGTCGCGCCGAAGGC
CCACCACCCGAATAAGTTGAGTGGACTGGGGCATGGATGTCCTCCAAACGGACAACACCCAAGTGAAAATGAACCAATTGCCAACGATTGGCAATACGAT
GATCTTAGTGTGATTGGAGAATCGCACGTAGAAGACCTGGCCGTGGTAGCGCAACCACCACCAGAAGATAACGAGGGAGCAATTCCACTCATGTCATATG
ATGAGATAGCCCAAGAGGCTAGTGAGGGAATAAATCCCCACCCAACTGTGGAAATAAGTTCCCAAGAGACAACAGAGACATTAAAAGTCCTAGTCAATGA
CGGATCAAGCATAGGAACTTGCCAACTTGATCTGACCGCGCCTCTGAAGACAGCTTCGGAGATCATTCAATTGCCCACGCTCGAACAGAAAAGGTTCTTG
CGTGATCTCCGTAGTGGCAAAGTCAAGCAGGTCTGCGTACTCGTCGCGGAAGATGAGTACGCCAGTGACATCCGATTGGCAACGGTCTTTGCCGATGATG
AAAGAGTTCTCAGTATCTCATCAATGGACGAGAGTGTCCTTGATGAGAAGTCTCGGATTGCGCGATATACATCCCAATCGTGGGAATCACTCGAATCAAA
TCCTCTCTACGATGATTTGATGTAATTCAGGGATGTATTCCCAGAAGCATTGCCGTGCGAGTTACCTAATGACAAACATACTCGTCACGAAATCGACCTG
AAACCAGGTTCGAAGTACTGTGTCATGAAGTGATGGCCATTGCCATGTGAACAAGTACTAGCGATCGACAAGTTCTTTGCAGATTTCTGAGCAGCCGGCC
ATATGAGGGAATCAACTTCCCCTCACATAGTTCTCCGACCTTCTGTATGCAGAAAACCATGGGAGGATGGCGGATAGTATATGCCTTTAACAAGTTGAAT
GCTGCAACTATACCAGCTCAAAGGCCAATACCAGGGAAATACGTAATCATCGATGGTATGGCAAAGAGTACCATTTTTTCATCAATGGATCTGATGAACG
GATTCTATCAGATCCTTTTGAGAGACGTGAATATTCCTTTACTGCAGTGATCCCCCCAAGCAGTATGCTTTGGGAGTGGTTAGTAATGCTACAAGGGCTG
AGTAATGCCCTGCCACATTCAACAGATGAGTTACAGATCTGTTGAGATCTGTGCGAGAATTCACACCTAGCTATTTCGATGACGTGTTCGTCCATAGTGT
ATATTTGCTGCAGGCGAAATACCACTTCTTGGATGAATCGTGGGTAAGCACGGCGTCCGGCTCAATCCGGAAAAGATCAAGGAGATCACTGACTGGCCGG
TGTCTACCGACATAAAAGGACTCCGAAAGTTCTTTGGCCTAGCGGCGTATTTGCACAAATACTCGCACAATTACG