Description :
From Genome Similarity Track
Location :
Scaffold_89:60252- 61374
Sequence
1122 bases(100 bases per row)
ATCGTACTGTTCACCCTCTGACGTGTAGTGGATTCCAACTACACGTTTCGCAACGGTTATCGACGCACCTGTAGCAAGGAACACCGTCATCATCGTTTGA
GGGATGTCGCGCTCAACGAACTTGAGCCTACGACCCTCTATCGACTGACGACGAACAAAGTTGTTCGACGCCCCACAGTTGACTAGAGCACGAAGTGACA
ATTCATTTTTCACTTGCAACTTCAAGGTGATGAGTGATATCTCATCACCAGGTGCAGAGACACACAATGATTGTGTATCTGGAGCAACATTCGTCATGAG
ATTTGCAAATTCTCTTGAGGTTGCTGGATCAGTAGGGCGATCCGCCTCTACTGACCCTGACCATTTTTTATGGTCCGCTTCGCTGTTGCGGTTTCGCAAC
AGCGTTGGACCTACGCCGTTTGCCCTCTTGGCAAATAGCCAATCATTTCTCTCTGTACTGTTTGGTACTGAGCGTGGGGCACTACTCTTAAGCGTAGTGC
CCAAACTTCTGGCAGCGGTTGCACTTCTGGAATCGCTTGTTGTTTAAAGAGCGAGATCTCTCGCTCTCAACATAACAGAGGTCCATTGGTTCTGAACCTC
CAGTCTCTTGTCGTCTCGGTGGACGATAAGAGCTCGAGCTAGCATGAGCCTGCCTCATGCTAAAGTCCTCCTGTTCCGCAGCTGAGATTGCTTGTTCAAG
CGTACCCAACTCTAAGCGGAACAGGTGGTTCCTGATGGGCCCATTTACGAGCCCTTGCATGAACACAGTAATCAATGTGTGTTCATGGACTGGGTTAGCA
ATTATACTACTCGCGAGGAGTCGTATATGCTGAGCGTAAGCGTGCACATCACGCTTACCGTGCTTGAGTTTCAGAAGCTCTGACTGAGCCCTTAACTCAG
CTCTTGGCGGCTCAAACAGACGTTTGAGCCGGGTTTTAAAGGCTTCCAGCGACCCAAAAGCATATGGGTCGCTCTTCTCCAGCCCTAAAGCCCAAGTCTT
GGCACGCCCCGCCAAGTGGGTTAGAGCAAATGTGAGTTTATTTACTCATCGTCGATACGTCGTGCCTTTATGGCTCTGTCTAATTCGACGAACCATAAAA
ACAGGGAGTCTTCCTCGACTCC