Description :
From Genome Similarity Track
Location :
Scaffold_12:6025- 8018
Sequence
1993 bases(100 bases per row)
ACGACGCGACCTCCCACGTCGATAGAGATGTCCGACGCGCTCTGCGAGGCCTGATCAACTTGAGCTGTCAGGGTCGCCATCTCCTGCTTCAGAGCGGCGA
ACTCACGGCTCTGAAGCTGCTCCACAGCAGCGACTCGCTCCTCGAGGGTCGGGCCAAGGTCAATCCCAGGTTGATCATACCCGGGGCGTGTTCCCACCAC
CGCCGCCTCCGATCCGCGACGCCCGCGGCTCAACACGCTGGATTGTTGAGCGTATTGTGGACCATAGTATCCCGAAAACGAACCGGCAACCGGTTCGTTA
TCGTATTCGTTGGAGAGGATTTCCGCCCCACCAAGATACATGGGAGCCACGGGACGTCCTGCTGCAGGACGTTCCGGAAATGGTGAGGGCGTACGAAGCT
CACCACGCGCTGCCGACGCGAAGGTAGTGCGAGCGCTGTGGTCACCTACAGCGCCCGAGGTCCCACGATCGTCGCGTTCCTCGCGTGCCAAGAACTTGGC
ACGGAGATCCTTGAGACTCTCAGGTACACGAATCGTCGTGTACCCGTTTAGGTCGCGGTCGCTCAAGCGCACCCGCACCCGGAAGACACAACGTGCACTG
ATGGCCTTCGGGCACAGCGCATGGAATACCAGCGTCCACAGAGGATCTGTGGAGCTGCTCCAGCCTCCCGCGCGTCGAGAATGTCTCGAAGCGCTCACGG
GCATGCTTAACCCGCTCACGGTAAGCAGCCGGCTTCTTGTTGAAGTTCTCAACGAAAGCATTCCAACTTTGACAAAGTGCCTGCCACTCAGGCACTTTGC
TGCGAGAAGAGGTATTCTTGCTGGAGAAGTATCGGAGCTCCTGAAAGAGTCCGATATAGTAATCGCGCCTTTGATTCGTTAACGGATCAAAGTGCTGCTC
CTCCGCCACAGCATCATCGTGGATCCCGCTGCATACCTACAGCGGGATTTCAGTTGGAGGCACGGTGTTGCCCACACGGTCTGCGATCTATGACGCAGAT
AGCATCCACGGATCGCGCGCTGCCTGAGCAGCGCGCGGAGAACTTGAAGACCCACCTCACGCGGGGAGCTTAAAGCCCCAGCAGCGGAGAGCGGAGTGTC
GCTTTCGCCGCGCGAACGCTTCGAGCTTGAAGCGTCCGAATCGTCTCCTTCACGAGGGCGTTTGACCCGGTATGCGAGTCGAGACTATCACTGTCGATAG
ACTCTTTGCGCTTGTTGGAAGAGGCCTCGCCCTCTTCCATCTCCACGTCATCATCCCCGTAGTCAACGGCGTCGTTGACTACAGAGGAACCTTCGAGGAC
AATCTCCGACTGGGTTGTCCCCGACGCGGCCTTTGCCGCGAGCGCATCGCGCTTTGCCTGCTGGCGCTCATGGTACTGAGCAACAGAGAGCTTACCCTCT
GTTGGGGCGGCGGTCTTCTTCTGAGACGAGCTCATTGCGGAATGAGCTCGAGTTTTCTTTCTCCCAATATGAAAAATTGACGAATGGTCAATTTCCCGAT
TGACGTGCCGTGTCTCGGCGCGTCTAACCTTGACGGGGGGATGGTGTAACAGGGTTACACGCACAAGTGGCTACAGTCACTTGTAACTCTAACAGTCACG
ACGTCTGTTAGAGGTTCGAAAGACTTTCTCGACTTTGGTGTAGACACACCAAAGGCTGCATACATTTACGATCACCACGAGGGGTGGTTCATAGAGACTT
AGGATTCCTATTGGCTGAAAGCAGCATCTTTTAGCCAATGAGCGACATGCATAGCGTAGGAATGCTGCCAACCAGCCGTTGGCAGATTCCTATCTTAGAA
TATTACATTTAGAGGAAGTCAGAAACATAAAACAAAAATAGCAGTTCTCATTTTAACCCAAAAACATTATTTGGATCGTTTATTTAGATTAATCTATACT
CGGAGACCCGAGTATATTTAACTCTAAGTTAAACTAGGCTACGCTTCCTCACATACACGCGCACACGTGTAAGCTAAAGTAGTGAGCAAAAGT