Description :
From Genome Similarity Track
Location :
Scaffold_24:60249- 62286
Transcript NameFunction/comments
g4771.t1hypothetical protein

Sequence
2037 bases(100 bases per row)
CGGGTTTCATGCGTCTCGCCAACAAGACCCTAAGGACACGAAGCCGCCTGCAGGGGCAATGAAACGTTTAACAGCCGCAGATTGCAGCAGTAACGATCCC
AGTACGGCGACGGAGAAAGTGGACAACCAAGTTTTCGGTGATCACGGAACAGTGGATGCTACTGTAATGGGATTGACAGTGCAAGCGTCTTTGCTTGACT
CCGGCGCTGATGCTTCTTCGGTGTCTCGTGGATTTATCTCAGAATTGCATAAGCAAGGCCGATTTGTACCTCTTATCAACCGTGAGACTCCTAAAGAATT
TGAGCCTTTTGGTCCGGGTACTGTGAAACTCTACGAGCAAGCCAAATTTGACAAAGTCGTCCTGCACACGTCAGCGGGACCGCTTGTGATGCGGAACTTG
GAGTGCTGGATTGATGATACTGACCTTACGATGGCGCTGACAGTGGGTCGCTCAGTGATGGTGACGTTAGGATACTCGACGGACGGACTGTTGGTTTCGG
CGCTGGAGAAACAGACAGAGTATGTGCTCCCCAGTGGAAACAATGTCTCACTGTCGCCTCTCATGAGAGCTCAGCAACTGCGCGAAGTTTCTTGCTATGA
TGACGGTGCTGCGGATGGAGATCCCTGTGCAACTTCAGTAGCGGACGACAGTTTTGAATCAAGGGCATTCTTACCCGAGACAAAAAATGCCGAGCAAAAT
GCCAAACTAGTTCGCGACAGTCTGTTAAGTGCGATCGAGGATGCGAGGAAGAGAGGTTTGTGCGGCGAAGCGCTGAGCAGACTGACAACCTCGCTGGAGC
AACATAAAGAAGACTTCTGTGTGATATTTGGGCTGTATCCACCCGTTGATGTGCCTCCGTTACGGGTGCAACTGAAGCCGCACGCTACCCCAGTTCGCTG
TTCTGCGCGGCGTTATGCTCCATTGGAGCGAGCATTCATGGACGCTCACCTCGCTGAACTTGAAGATTTGGGGCTCGTGTACAGAAACTACAGCAGTCGG
TGGGCTTCAGCACCACGAATAGTGCCCAAGCCACCCCCTGCAGACTTCAGAATGTGCATTGACTCGAGGGCTGTCAACGATCAAACTATTGGAATGCAGT
GGCCCATGCCCCAGTTAGACGTAGTTATCACACACGTGGCTGGAGCGAAAGTATTTTTCATTTGTGACTGGTTTCGCGGGTATTGGCAACTTCCGTTGCA
TCCAGACTCTCAGGAGATTTTCACCTTCATGACACACCGTGGCATGTATACTCCGACCCGTGTACCAATGGGGGCCAAAGATGCAGTGGCTTACTGCCAA
AGTGTGGTCGAATTAATCTTTGGTGACTTGTTGTATCGTGGTGTTCTTGTGTGGCTCGACGATATCCTCGGTTATGCAGAGTCGGAAGAAGCACTTATGG
AACTGCTGAAAGAAGTTCTTCACCGTTGCGCCAAGTTTGGCCTTAAGCTCAATCCTGCAAAGTGCCAATTTTTCGTGAAAGAGGTCACGTGGTGCGGGAA
AGTCATTTCTGCCGATGGAGTGAAGCACAGTCCTGAAAGAGTTCAAGGGTTGGTTGACTTAGCGTCTCCTACAACGGCTGCCGAACTACAGCAATTCGTT
TGTGCCATCAATTGGATGAGAGCCAGTATTCCCGAGTTTGCCCGTGTCACAGCCCCACTCTACGATATTCTCGAGAAAGCAATGCAACTCAGCGGTGCGC
GTACGAAGCGTAAGCTTGGCAAAGTTTCGCTGGCTAGCGTTAGTTGGGGTGAACAAGAAGAGGACTGTTTGGCGCAAGTTAAAAGCAAACTTCTTGGGAT
TGTGCCACTTGCTCATCCAAAAGCTGACTGGGACGTTGTACTGGTAGCTGATGCCAGTTTAGATCATTGGGGCTCAGTATTAACTCAACTGCCTCCCGAA
GACGCAAGTAAGTCGTTGTTGGAACAGCGGCATCAGCCTTTAGCATTTCTCAGTGGACACTTTCGTGGATCGTCGCATCGCTGGCCCACTATCGAAAAGG
AGGCGTTTGCTCTGGTGGAGTCGTGCAAAAGACTGGA