Description :
From Genome Similarity Track
Location :
Scaffold_231:6024- 10251
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_231-snap-gene-0.15Malonyl-CoA decarboxylase (MCD)
Pytap_DAOMBR444maker-pag1_scaffold_231-snap-gene-0.16EF hand-containing protein
Pytap_DAOMBR444maker-pag1_scaffold_231-snap-gene-0.28Protein phosphatase PP2A regulatory subunit B

Sequence
4227 bases(100 bases per row)
GCCGTCGACGTTCCTACAGTCCATCGACCTGAACAaCCCGAGTTCCGATGATCGCCAGAGGCTGTCGAAGCTCATCCAGGAAGTCGTGCAGACCAAAGCC
AACACAGGCGGTGCGTTCATGCGGTGCGAAAGCGACTGAGGGATGTGCTGGATGTGACAATGTGTTGTGCGCGCGGAGCAGACTTTGTGCCCCGCGTGAT
TATCGGAAACCTCTGTGCCAAGTACCGATCGCTCAACATCGACGAGAAGAAGCACTTCCTGCTCATCCTGGCACGGGATCTTCACGTCGACATCTCGTTG
GTCGAGCGGAGCCTcAACtATTTtGCGgAgAACTTtGCGCACGTCCAGCGAGACGCTGAGGCGCCAGGGGAGAGCGAGATCGAATGGGAGCATGAGCAGA
TCGAGCGGTTCCTGCGCACCTTCCGCAACTTGCGTACGTCCCTCACGCCGCTCTACGAGGTAGACAAGACCACAAGACCCATTGGATTCTCAAAAAGCTG
TTGACTGACTTGGTCTTTTtGGAATAGACCTTCTTTCAGCAGGTGCTTTCGCAGCGTGAGGGCGGCATGCTTTTCCTTgtCCAGATGCGAGCCGATCTGC
TTCAGGTGCTACGGAAAAACGCCGATCCCGGCCCGGAAGCGTCGGCATTGCGCTCATTGGATGTCAGTCTGAAGGTGAGACATAGCTGACTGGGTCTTTC
GATCCCGTCcTTCCTTCTCAGTGCTTCTtaTtGCTGCTTgTAGAACATCCTTGCTTCATGGTTTAGTGTTGGTTTtCTTAAACTCGAGCGCGTCACGTAC
GAGAAGTCGCCAGGACAACTCCTGGAAAaGATCATCCGATATGAAGCAGTTCATCCTGTGGGGACAATCATTGAGCTCAAGCGACGACTAGGACGCGGGC
GTCGTTGCTTCGCCTTCTTCCACCCAAGTGTACCTGATGAGCCTCTTGTCTTCGTCCATGTCGCCCTGGTGAAGGAGCTAGCTGGAAGCATGCCGTTTAT
AAAGGAaGAaaCGGAGAAGATGGATGATGAATCCCAAGCGCGAGCTGCTATATTCTACTCTATCTCTTCAACGCAGAAGGGTCTTCAGGTGAGCAATCGA
ACATCATAAGTATGGTGACCAAGTCTGACGCACTGATACGcTAGGGAGTGGATCTCGGAAACTTCCTAATCAAAGAAGTCGCGAAAGAGTTGACGCGCGA
ACAGCCCCAGCTGCGGATCTATTCAACGCTCAGTCCGATCCCAAACTTTGTTCCTTGGCTCGAGAGCCATCGCAACAACGATCAGCTTTTGCATCCATAT
CCAAGTGAAATGAAGGGGTTGCGCCAAGTTCTTGGAAGCAATGCGGCAACTGACGTCGGAGTTTTGTTAGAAGCGTTGTCCGTCGAGAATTGGCATGAGA
AAGACGATCTGGCGTTGGCTCTCAAGCCCATTCTCCTACGCCTCGGTGCTCGCTACATCTACCAAGAGAAAAAGCGTGGAAAGGCACTGTGCCAAGTTGC
CAACTTCCACATCCGCAACGGAGCCATCTTTGAGCGCATCAACTGGCTCGGGGATCCTTCGGCCAAGGTCCGTAATGACGACATGTCCTCAAAAAGCTCG
ATCCTCGCTAATGCCTCTTTCATCTGACTGTAGGGCCTTCGCCAAAGTGCTGGGATGATGGTCAATTACAAGTATGACCTTGCCCGCGTCGAGAACAACA
ACGAGAACTATCTGTTACAGAACATCATTGCCATTGGCGACCAGCCCAAGCATCTGTTGGAGCTGCCATGAGCTGTATCCCGTCGAAAGCTCATCTTTTT
TTtGTtCTGGTAATATGACGCGCTCTTTTGCCACCACATACAGATATCGTCGGTTACTTTGCCTACAGGATCAGAACACGCGGCTTTCCATTCCAAGCGT
CACCCTCAAGACGTTGTGTTGGACTTGGCATCCTCATGGTGCTCGCTCAAGACGAGATCGATGCGTGCCGCGAGGCGTTCCTGGCGTTCGACAAAGATCG
GTGAGTGCAGACTGTGGTGGCCAGAGGCGCTCTGTCTATGGCACACGCGCCACCACTCTCATGGACATCTCGGGTGTGCCTGGCCCTTCTGTCATCGCTC
GCATTTGTTGATGGCAGATCACTGATAAGAGATGACGTGGGCATGCAGGAGTGGCACGATCGATGTGTGGGAGCTACGGCAGGTGCTCGAAGGTGCGATG
CCGCGTTCTTGGATCCATCCCTGCGTGATCAAAGGAACTCaCGAGTATGGACTGGTCGCACGTAGCAATGGGCCAGCAGCCGACCGAAGAAGAGCTTTTC
CAGATGATCAGTGAAGTGGACGAAGACATGAGCGGCGCGATTGGTACGTGGTTGATGAGTGCCAACATCTCAGGCACAaCCAAGTTGACATCACTGCCCA
CCCCCAGATTTCGCCGAGTTTCTGCAAGTGATCGATAACCAGAAAGATCGTGCAGCGCTGTTTGAAGACGACAGCGATATGAGTGAGCAGCGAGCTGATA
ATGTAGAGGATGAAGGGGTTACTGATGGCCGGGATGCTTGTAGTTGATGCCTTCGTGGCGTGTGGTGGCAAGCCCGATAAGAGCGGATTCGTGCGGAAGG
ACACACTGATCAAGATCATCAAGCAGGATTTCGGCCTGACCATCAACATTGAAGAGATGATTAACAAGCTGGACGTGGATGGCAGTGGTGAGATCGAGTT
TGACGAGTTCAAAGCGATTCTGACATAATAGCTCGATACGCCAATACAGAACGATACCCATGCACGTGATGGCTGCAATAGTACATGTACATTGATACAG
ATAGGAAGACTCGGCAAAAGATCCGTGGTGCGGTGTCTTTGCATGGATGCAGATCGCTCTTGCGCCAACTGTGGCGAATTCTACTTGCATGACTTCGATC
TGGTGCTGGACGTCGCCTTCAGCAGCTGTAAACGTATAGACTATTGCGAATCGCCACCGCGACTTCGTTTTGAGTTGGATGCCAGCTCGTTTGAAGCACT
TTCTTGTTGAAGTCGAGGCCATCGGTCGGTCCTGCAGCTCCTGTTTGACCAGCAGCACAAACCGGTGCATCGGCCGCGGCAGGAGCAACTAATGACTGCG
CGATCATCGTATGCGGCAGCGAGTGACGTCGACTGGCGTTCGATACACGGGGGTTGGGCGTTAGGCAAATATCGCTGCGCCCGTATCGATCATAAATATG
AAATTCGCTGTTGTAGGAGCCGGTGATGAAGTTATTGCCGTCACCGCTCACTGCACACTCAAACTTGTCGAATATACAATCGCTCTCGTAGAGATCGCTG
AGGCGTGGCCGCAAATGCTCATGGATCTACACGAACAGCAATTAGATCATACTGTCCAAGTGTCCTCCTGAAGTCGATAGATGTACTCACGTTGATAGTT
TGCACTGGTCTTGAGTCCATGTTGATATCCCAGATTTTGAGAGTAAGGAAGTCGCGCGCGATAATGTAGCGCCCATCTGGCGAGAATTTGATGTCTGAAA
TGgaGGCGATAATCTCTGAGAAGAAGCTTCGAGCCTCGGGGTCTTCTGGCTCTTCATACATCTTGCAGTACGAGTCGCAGAGCGCTGCCTGACGCATATC
GCCGAGTTTGATGGCGCCGCGACTCGTGCTGTACATCATGATGTTGCAATGCGACGGATGGAAATCAGCAGCGGTGATGACTTCAGTGAGCTCCTCCATG
TTGCGCGGTTTGATGTCCACGATGTCTGTACAATAGAGCGAACGCTGATGGTCAGTTCGTGTTGAATGCCACCTCGTCAACCTCACAGCCACGTACTGAA
GCTTTGGTCGGAGATGGCGAGGCTCCACAAGTTCACACGCAAGTCATCGGCCGACATGAAGGTTTCGCCGTCACTATTGAGTGCGATTGAGTTGATATGG
TACGTGTGGGCATTGGCATACGTTCGCTTGTTGGTCGACGTCGTGACGCGGCTCCGTACAGCAGTCTGTGGCAGTTTAATGGACTGGATCGGTGGCTTCC
GAATGACCCCCGATGGCTGCTGCGCCGTGTTGTACTGTGTGACTTCCCAGACGTTCCGTGCATGCACTTTCCACAGCTTGACGGtCTTGTCGTTGGTCGA
GAGCAGATACTGCGCGTCATTCGATGGTCGGCACCATTTGATCTGGTTGATCTTCTCTTCGATCTCGAGGCTCTTGAGGTAGTCGAACTCGGCCTTGTGG
CTCACAAACTCGGTGTACGGTGTGTAC