Description :
From Genome Similarity Track
Location :
Scaffold_299:602382- 615789
Transcript NameFunction/comments
Aphin_H310_02665dynein heavy chain

Sequence
13407 bases(100 bases per row)
CTAATTGTCGTCTTGAAACAACAACGCGACGCCGCGCAGGACCCACTTTTCCCGGCCACAGTCCGTGGGCAACGTCGCCAGGAGGACGTACGTCGGGCCT
CGGAATCGAGTGAGGTACACCGGACACTCGTAGACGAGGGGGTCGTGGCGGAGGTACCCCACACTCGTCGGTTCCCACAACGGTTTGGTCTCGACCGCTT
TGACATACACGACCGGCATCATCCACAGCAGTTCCTTTGGGTTCGAGTCCACGATGACGCCGCCGCATTCCGTTGTCGGCGACGTACCGACCTTGTACCG
GTTGTTGACCTCGTCCAAAGTCGACCATCGCGCGCCTTCAATGTACAGACCAAACACAAACACGCCGTCGTCCGGGTAGTAGTTTGCCGCGTCCACCGAT
CCAAACGTCGTCATGTGCGTTTCAACAGTCATCTTGTTGAGCGGCATCCTACAAAGGCAACCCCATGAGCCATGCACAGCAAGACCACGGGGGGGGGTGC
CACGTACATTTTCCGCCGGGACGTCACTTGGAGGCACGCCGTCGTGTACGCGGTCGGGTTGAACAAGCCAGGGAGCCACAGCGCAAACGGCGTGACAAAG
TCGACCGACCACACTTGCAGTTGCTGGTGGCGCTTGATCATGTCGACAAACCAACCGCTCAGCGACTTTTTGGACGGCCATGCTTTCTTTTCCCATTTGC
ACTGGGAGAACGGATTGCGTCCTGGGACTTCGTTCAGGCCAATCGCTGTCGCCAAGTCCTCCATCGCTTGGCTCATGTTGAGCTGTCCGTTCAAACCTTT
CTTCAAATCCGCGAGCGACTTGCGCAACTCGTCCAGCAGGACGTTCATTCGATCGCACTCCTGCATTGCCACGACAACAAACGGACCATGGTCTGCCGTC
AGCCGCGGCGCCGCAATTTCTTGCAAATCCAACATGGAAAAGAACTCGGGCGTCCGCGCCTCAAAGTCGTCAATCGAGGCTTTCAACATGGCCGTTTTGT
CCATGCCGCCCCCGCCACCACCGCCGCCGCCCCCGCCACCAATCGACACGATCGCGTAACACAACGTTTCGCATGTGGTCGTGAGGTACCCGATTTCGGC
GTTTGGATGGAGCCCAAACAGGGGCGGGCTCTCCGCCACCATGTTCTTCTCAATGTACTGCGCGTAGTCGTGAAAGGAAAACTCGGCCGGGTTGGGGCTC
TTGAAGCCCGGGCCGAGCTCCATCCCGGAGAGAAGGCCGGGATTCAGCAGCACGGTCAAGTACGTGTTGTTTGTCCGGCGGTCCCACGAATCCGTGATGT
GCCCGCCGTACATGATTTCGCCAAAGATGTACCGGAGATCGTCCCACGGCACTTGCTCGTTGTTGTCGAGGTAGCTCATGAGAACGTTGCCACAAATGGT
CAAGTCGCCCGTGTTGAAGCTGTACGCTCGACTCCACCCCTGCTGACCAAATCGCCGCCGCCCCAGCACAATCGCGTGGAACCAGCACAGCGAAAACAAA
CACGCTTTGAACTCGGTGGGCTTGGTGCTAGCTTGGACTTTGTCGTCGCCAAACGTTGCCCACGCGCGGCGCAAGTTGGACTGAATGTCCGACGGCGCTT
CGTTCGCCACCTTGATGCACGACTGCATGAGCGACTCGGGCACGTTGAGCTCCAACGGCAGCAAGATTGGCGGCGGTTCGGCCGAGATAAAACACCGAAA
CATGTCGTGTGGTCCCTCCGCCACGATTTCTTCGAGCTGACGTTCCAACAGCGGCAGCCAGCTTTGCATCAAGTGCACGTTTTGCAAAATGATCCACCCG
CCCTTGGTCGCGAGTTTCTTGAGACAGTCGCCGGCGTGTTGTTCCTGCCCTTGGCCCATCGAAATGTTGATAAAGTTGTCGTTCTCGACGCTGATGCCTT
TGGTTCGGCCAAGGTTCTCGACCCATGGCGTCGGGTCTACCCCCGGAAACAGCACAAAAAAGATTGGGATCGCCGGGTTCGTTTCTTCAAATGTCTTGAC
CATGTCAAACGGGGGCTGCGACACGTACTGCTCCCCGAGCGACTCTAAAATAAACGTCCGCAGCGCGTTCGTGACTCGATCGGGACGCAAGGCGCGGAGG
AGAATGATCTTGGAAAACGACGACAGTTTACTAAAGTCACCCGGCAACTTGGCAACCTCGGCATCTTCCGCGGCAAACCACTTTCGCCACTCGTCGGGTT
CATTCTGCATAATGTCCCCGAGGTTGTGAAACACCTTCATCGTTTCAAGTGCCTTGAGCTTGGCAAAGCACGACGCTGGCAGCCACTCGGCCAACACCCC
CATGTTCCCCGGATCCGCGACCGACTTGCCCAGCAAGAACGTTTCGATCTCCACGTCACTCAGGACTTGGTCGCGCACGAGGATTTTCAGGCACAGCATC
GTGGCCACCGTGAGCTTGTCGCGTTCAAACAAACCGCGACGAATGTAGTCGAAGACGCACGTTGTGATGGAAATGATGAGCGCTACAAGGTAGTCGCGAA
CGTCACAGGTTAGGATGCCACCGCAATCCATCGAGACACGGTAGGTCGGGGTGTTTACCTTTGCATCGCTTCTCAATGTCTTCGTCCGACAGATCCGTGG
ACGGCTCGTCTCCAGGGGCAGGAGCCCCTCCGTCGGGCGGTACCTCCGCTGGGACGTCCCCGTCGGCGGGCGGCGGGTCCTCGACCTCCTTCACGACAGG
CAGGTTGTAAATCCCTTGAAGAAACACCTTCTGGAACGCCGCGAGCGAGTAAATGTAGTACGAGTGGACTTTGGACAGGTCGTTCATGAGGAAAAAGAGC
AGCGAGCCGCGGGCGGCAATGCTGCGGTACTTTTCGCTCGTGACGTTGACGCTGTCTTGCGTCCTCTTGGCGGCTTCCATGTTGGTTTGCGTCATCTGGG
CCTTGTACTTGGTGTCGCTCAAAATCGCAATCAAGGGCTGGTTGCTCGTGATGTCGTCGTCGGCTTCGGCCAAGTACTGCAAAATGATGTCTTCGAGTTT
CTTGAGCTCAATCTTGCCTTGGTTTTGTTGTTGGATGAGCTTCTCGCGCTTGATGGCCAGGTCGGACCGCTCCTTGCTCACGACCAAGTTGAGCAATTGG
TCTTCGAGCCCCAAGTTGGTCACGGTAAAGTTGACCATCGTGCACTCTGCTTGAATTTCCGGCGGGTAGTGCGGGTTCCCGAGCTTGGTGTGCAAATACA
AGCGGAATTCTTCGCAGTACGGGACGGACGCGTCGCCGATCACGATTTCCACGCGGTTCCCACGCTTGGACGTGCTTCGCTGAATGACCGGCGCAAGGAT
CGCATCAATCTTTTCGCCCAAGTTTTCAATCAAGAACGCGGTCTTCGTCCCGATCGCGGATTTGAGCTTGTCGATCCAGAATTTTTGGCCCATTCGGACA
ATTTGGAGGTTGTACGGGGCTTCCTTTTCCCGGATCCACGCAATTGCTTGGAGCTGGGGGTCAATGATAAGTGGCCGTCGCCCTAGTCGTTCGACGTCAA
GCGAAATCGAAATGAAAGGGTTCCATACCCATAGCAACTGTGTTGACTACGATAGCGCCGTTTTCCGTCGACACGCGGTCGGCAGGGAGTTTTTGCGTAT
TCCACTCGGCGATCTCAGCATCGTTCGTCAAGATGTACACAGGATTGCTCTCTTCGCTCATCGCGATACTGTTGCCGTTGGCCGCTTTCCGCAGGTACGG
GACCCAGTGTTTGTTGATGAGCTCGTCGCGGAATGGCTTGGTAAACGGGCCAATGTACGAAATGAACGCGGACGCGAGGAGGCAGTCGCCGACGAGCAAA
TCTTTTTCCTTTTGCAACTGCAGGACGTTGATGCCCCATCGGACGTTTTCCGACCCCAGGTCTTTGGTCAACGTGCCGGCCAGCTTCATCTTGCGATTCC
CTTGCTCGACGGAATTGATCGCGTCTTCCTTTTCTTTTTCGGCCGCCGCCGCTTCCTCCATCAACTTGTCGAGCTTCTCCTGCAAATCTACGCCACGACA
ACGTCAACACCTACACAGGTCCAACGACTGCCACGGCATACCAGCGACCAACGCAGTGACCTCACCGAGGCGTTTGTTGGCCGATTCCAGTTCCAAGTTG
GCGGCCGCCAGGGCCATGCTACGCGACCGTCAGAAACAACACGCGTCAAGGGTGGTCCCACATACCGTTTTGGTTCGACCGTGATGAGAATGTCGTAGTA
CATGACAATGTTGACCACCCAACTGCACAATCCGGCCGCTGCCTTGTTCTTGGTCGCAATAATGTCTGGTTTGAAGTGCTCCTTCTCGAGGAACTCGCGG
ACTTCCTTCCAATTCGTCGTCGGGACTTGACCCGCGTCGACAATGTCTTTAAACTTGATCAAGTACTCAATGTACTCTGGAATGTTGCCCAGCACTTGCT
TCTTGCACGCGTCCCACTTGAAATCTTTGACTTTGCCTTGCTTGGTCACGACAATGTTGGGGTGGACGCCGGCCAAGAGGACCATGGTCGCCCCGAACAC
GTCGTCCACACCGGTCGGCGGTTTGCTCATCGTTTTGCATTCGCCGAGATCTTTCTTGTTGAGCGAGTCGAGCGCTTCCATGGCTTGTTGCACGGCGGGT
TCGGCCTTGGCGAGATCTTCCATCGTCGACCTCTGCTTTTCCGTGACTTCGGCTTGGATGATGGCGCACTTGGCCGCTTCTTCGGACGCTTTCTTGGACT
CGACTTCGACCTTGGCTTTTTCTTTGTTGACTGTCTCTGCAATGCCAGACGCGACGGCTTTCTTGTCCTCGGCTTGCTCTAGCTTGACCTTGAGCTCGAC
CTCGAGCCGAGCGACCGTGTCCCCCGTGTCCTTGAGCTTCTGCAGCCCCTTCTCCAATCGTTCGATTGCACCGGCGTACTCTTTGACCTTCTTGCGCAGG
ATGTTCTTGTAGAGTTGGAGGAGCTCCAAGTACGACTTGGGCGTTGTGTACACATATCTGGTCGCCGACGTGGACGGTAAGGACCATGTCAAACGAGATG
AAACCACGATCGTACCGTCGTTCGACTTGGAAGAATCGCTCGGCGCATTGATTCACCGACACAAACGAAAACGGCATGAAGTTTTCAATGCCGGTGCGCG
AGTCGTCCGAGCCAAGGAGGTCGCTGATTTCCTTGAGTTTTTCCTTGCCCACGGACAACAGCGCTTCCTTGGGCCACGGCTGGAACCAATCGATGACGGT
GCAGTTGACGAGGGCAGGAAACTTTCGCGCGCGGCTGCGAAAGTCGTCGCCGACGGGGCTGAAGCACAAGCACAAGTGCAACCGCTTGCGGATTTCCGAC
TGGAAGAACTTGATGACTTCCTTCCGGTCCTTTGTCCCCGCCATAACGCAAACCTACCGACCACACCACATTAGCACAACGAACGGACGGACGGACGCCG
GACCATGTTGACAATGTTGTCCATGTCTTCCGTTGCAAACAAGTCGGGAATGTCCCCCGACGCGAGCAAGTCGTTGAGGTAAATCAAAAACTTTTCGTTC
GTGATCTGCGAGTCCGTGAGCAAGAAGACCACCCCACCCTTCTCTTCGCTGCGACTGAGCTGGTCGACAATGACAAAATACATCTTGCGCAGATCTTCCT
TGAATTCGTTCTCGCCATACTTGGACGATATCGAAATCTGCTTGACAGTGTACTCGCAAATGTGGGACGCCAGGCGCGCCAGCGACCGCTTCCCGGACCC
GCCCACACCCACGAGCAACGCGTGGCTACCCAATAATTCACACACGCATGAGTGAGCGAAATGGGCAAGCAAACAGGTGAGCGTACCCGGATTCGTTGCG
TAAAATGCGGACAATGCGTGCCACGTGCTTGATAGCGTCGTCAAAGAGGTCGAGCAGCATGGCCGTGTTGTTTTCGTTGTTGTTGAAATCACGCAGTTGG
ATCTCGAGGTTCTTCTTGAGGTCTTCGAGGTTGGTCCCCATCACTTGGTCGTACTCGGGATCGCCGTCCTTGGTAAAGTGGCAGAAAATCAACGGCCACG
AGTTTTCGAGGGCGTAGTAACGCGACGTGTTGCACGTGGGGAAGCTGCGCTTGACTTGGAGTTGCACGAGTTGGTTGTACTTTTCAATGTCGGCCTTGCA
CACCAGACGGTCGCCGTACACGCGCTCGCTTTCGTGAAGCCAGAGCAGGACAAATTTCTCGGCGCTGTTGAATCGGTCCTTCTTGGACGCGATCAGGCCT
TGGAACACGTTGGACAAGTGGCGCACGTTGAATTCGTAGTGGAAGTTGGCCGCGGTCTTGCGGAAGGTTTGGACCACCGACGTGTGCAGCGTCAACGCGG
CCTTGATGAGGGAATTCCAAAACGCCGACGCAGACAGTTCGCCCGTGAACGTGCTGAGATGGCCACCCAAGAACGTTTCGTAGATGGTCACGAGGGATGG
CGCTTCCGGCATGCCCATGGCAAACGTGGTAAAGTGTCGCTGGAGACGCGGATCGACGAGGAACGACCCGGCCGTCGGATTCATCCCGGCCACGATTTGC
GTGTTGAGGATGTTCTGGAGCTGGAGCTTGTTGCGATCGAACCAGTGTTTGTACTCCATTTGCTGGCGCAAGAGGGAAATGGCCGACTGCGTGTTGTACG
GGTCCACTTCGGGCAAGTTCAAGTCGTCCAAGAAGTAGATGAGCCGAAACTTGCCGGGCGGACCAAAGTTTGACCCGGTCTTCTTCTCCAAGTGCGAGAA
CATCGTAGACTGGAGAATCGCGGACGTCGTGTAAAAGTTAAAGTTGATGGTGGCGTAGCGGAAGATAGACGTCCCGTCCTCCTTGGACAACTTCTTGAGC
ACGCCGTTGACGTTTTGGGTCTTGCCGGTGCCGGCCGGCCCGCACACGAGAATCGGGTGCGACTTGTTGATCAAGTTCTCGAGCCAAAAGCTGATGGAGC
ACGTTTCCGTGGTCGGGACCTGGGCAGGACATGGTCAGCAGAAATCCAACGCAGTCGGGGAACGAACCGTGATTTGGTTGATCGGGTCCGGGCTCTTGTA
CGTGGCCGTGTAAAAGTACGGCGACTTGCTCCACGGGTTAAACTTGGACGACTCGGGGTCGAGCCAAAAGTCAAACACAGTGTTGTTGGCGCTCGCGACG
ATCTTGACGTCTTTCCACGTATTTTTCCACCACGTGCTAAACTCGGCGGCGTAGTCCGTGCCGTCGTCGCTCACGGTCAAGATGGACCCGAACGCCCACA
CACAGCAAAAGACAAAGTTGTTTTGCATCACGGTGTAGTCGGCCAGGACCGCCGGCGTGAGCAAGCAGTCGAGCATGTTGAGCAAGTTGCCGATCAACGT
GACGTCTTCGACGGGAATGACGGGCTGCAGCTTCTTTTTGAAAAACTTGAGCGTCGGGTCGCAGTACTGGTTAAACAGTCCCTGAAAATTGTCGCGAATC
TCGGGCGAAAACAACATGGTTTGCTGGTTTGCTTTCTTGGTCGGGTCCGGCGTGCAGTGCCGCAGCAGCCACGAGTCGATCAAGCACCGCCACTGGTACC
CTTCCGTCGCCGAGATGTACAAGATCCCGGCTCGAGACACTGTTGCCGGCGTCGCGTACACCAAGTCTCGGATCTCAAAGATCATCCGCATGTGCGACTT
GAGCGGCACACGCTCGTTCGATGCCAACGTAAGCATGCGGTTGTCGTCCATGACCGAGTTCATCGACTCGATCCAGTTGGCGTCCAAGTCGCCGTCGAGG
AGGATCCACTTGGGCGACGTGTCATCTTCGCCATTTTCCTACCACAGCATCACGGTCTGCAATGGATGAAGCGCGAGAACTCTCTACCTTCGTGCGCGAC
CCCAAGTCGCGCATGATCTTACTCAGCAATCCATCCTTCCATTCCCTCGTCTTGAGCACAATGTACCCGTACAACTCGTTGGTCGAGACCGACTTGGGGT
TCAAATCTTGCACTTCCATCGAAATTCCCATGATTTCTCGAGCTTTTCGCAGCGTCTTCCACGTCTCCGTCTTCCCGGACGCCGGTGGTCCCATCACAAA
CACGCAGTGCCGAATCGCGAGCAACTCGGACAACTGGACAACTTTGAGCATGAACTCGTCGCGAGGACTACGTGAAGTGTCAATGCCATCGCACTGACCA
CGCCATGTAGTTGTAGTACCTGTTGTTGATCGCTTCGCACGCCCCTTGGACCATCGATTCGAGCTCGGGGTCGCGTTTGCGAGGAGGGTCGTTGCGGACG
TCAATGTTGGGGTCGTTGCGGGGAAAGAGATCCCCGAGAAGCCCAAAGAAGATCACGTTGTCCTCGACAACGATCTTGGGAATGTTGAAGTCGCGCAATG
CACGCATGAGCAAGTCGGGCTCGGGAATGTCGGGCTCGGCGCGCTTGAATGCCCCGGCGACGCAGAGCACCGACTTGACTGCGCGAAGACCCCAATCGTA
GTGCAATTGCTTGGACAAAAGTTGCCCGAGCAACGAATAGAGACCATAAAACTTGGACGCGAGAATCTTGGCCTGCGTGAATCCTTCTGCCATGAGCATG
TTTTCGCAGATCAAGACCAAGTCGGGCACCATGACTGTCATGGGACGAAAGAGCGCTTTTAACCCTTCCGGGAGCTCGGAACGCCCGAGGTACCCCGGGT
TCATCGTGATGAATGCGCCGACTGTCGGGTCCAGCATCACGGGCTCGTTTTCGAGAATGAATCGCTCGTCGTCCGCCTTGCACGCGTCACAGACGGCCTT
AAACTGCACGGAACACACCGACAAGACTTCCGGGACAAGGCGATTAAATTCGTCAAAGCATCCCCACGACCCCGACGACGCCAGGCCTTTGAAGATGTTG
CCCAGGCTCTTGTAGTCCATTTCAGGCGAACAGTTGAACACGTAACAAGCTTTTCCCAATGCGTTGGCCAAATCTTTGGTCGTTTCGGTCTTGCCGGTTC
CTGCAGGACCGGCCGGCGCACATCCCATCTTGAGGTTGAGGGCTTGGGTCGCTGTCACGTAAATGCGATCCGTCAGCGGGGTGATCACCAGCCGCGGTCC
GTTGCCGAGGTACTCATAGTCGTATGGAATACCAGCGTCGCATATGAGGATCTGGGCGCGCGAGTTGTTGGTGCCGCGGAACGCTTGATCGCGGTTCAAA
AAGCTGCCCTGGGCAGGGCTGAAATAATGCTTGAGTTGCGATTGCCACATGAAATGCGACGCAACGTCGACGCCAGCGCGCACCATGTTGGCCACGATAT
CTCGCCCGTGGGCGTCCATGGTGATCAAGCACATGACGCGCTGGCGCTCGGCATTGGAAATTTTGCTCTGAGTGAGCTTAATCAAGTCTTCGAGCTGTCC
TTCCTGCTTCTTGTTGTACCGAACGAGCGCTTCCTTGTCCCCGCCGGCGATAGCCGTGAATGCCGCTTCGACCTCAGCCACGTAATGGACGCCGGCCGCC
AACAAAATGATCTGCGCCGCGTCGAGAGGCTTCCCCGTCGGGTCTTTGTAGTTGATCCATTCGACGCGCGGTTCTTGCGTGTACAAGACCAAACTGCGTT
CGATGTGCTTGAACAAGGTGAACTTCATCGCTTTCAGCAGCGCCTCGAGGTAGATTTCGGCCTCGCCTTCGAGAAGCACGGGCTCGACAAAATCGACAAC
TTCTTGACCAACCCCCGACACAAACGCCGACGCCGTCGGTCGTCCCCCCGGGTTCGGAATCAACGTCATGGTCTTGCATGCCAAGTAGATCTTGGACGCA
TGCGGCATGATCTTGGCCGGGTTGGACCCGTTCGACAAGATGTCGAGCAAGTCCGCTTCCGACATGAAGTAGAAGCGAGGGAATTGTCGACGCCGGCCGT
CGAGAAACTCCTTGAGTTCGTGCTTGCACAGCTCCAACCGCTCGACAATGCCTTCTAGAAACTTGAACAGACCTTGCTTTGTGCATGCTGTTTTCACATT
TCTCGTGGTCCATGCCTCACGCAAGCTCTTGCGGACTTCGATGTCGATGTCCTCAAACTTGGCCGTCAGCGCCGGGAGCTGGTTCTTGACTTCTTCCGAC
TGGATAAAGAGCGGCTCCAAGTAGCTCCAACTGCGTTGAATTTCCCCGATAATGACGACCACTTCGTTCACGGACGCCAGACCTTCGTGCATATCGGTCA
CGCGCCCTTCAAACTCGGACTGGTACGGCGACGACGTCATGGTTTGGACATCGATTTGATTGGTTTCGAGCAGCTCGAAATTGTCTTCCGAGATCTTGAG
CAACGGCACTTGCTCATCTTCCGGGGCGGTCGGGTTATACGGGACCATTTCCCACTCGATTTGGCTCCACACGTCCTCGAGTTCCACGAGCTTGGTCTCG
AGCTCTTGCTCCTTTTCCGCTTCGTAGCAAATCTCGCCAATTTCGCTCGCGTACTCGTGCAACCGCTTGCTCAAGAGAAAACCGAGCTTTTGGTCCGGGT
TGACGTCCGGCGGCGTGAACTCGCCCGTCAGCGCCTGGATGCGCTTCCAGTGGCGCGATCGCATGTACAATGAGCTCAAACATCGAAGCAGCGGATGCGT
CTTGTCGAACGCTTGGCACTCCTTCAAGATCCACTTGTACGCATTGCACCTGACATATGCACAACACGACGTGAGCACGGCAAAACATGAAATGCCCTGG
CGGCATACCACTGAATGTCCTTGGGGATCTTCTTCAGTTCCTTCAACGTGGCCGAGATCTCCATGGCCAGCGCATTGCAATCGATCGAGAGCCACGGAAT
CTCGTGCGTCGCGATGAAGAACGCCTTTGTGCGTTTGATGATGGCCCACACTGTCTTGGAGCCTGTCGATTCCATGGTCAGTCGGCGAGAGGCAAGTGTT
ACACGATCGTACCTTCAATTTCGTTGCGTAACGCGGTCATCATCCTGTGGGTTTCCGTCATGAGGTGGGGAAATCCAAAGATGAGGCTCAAGTCGCTCTT
CTCGGCACAACGCTTCTTTTCGTTGTCGAATTCGACGAGCTGCATCTCAATTTTCTCGAGCGCTTTGTCCGGCTCGAGCTTGGCGTCCCAAAAGTCGAGC
GTCTTGATCGTGTCGCCCCACGTTTTGATCTTCTTCTCGTACAGGACAATCGCGGCCTCGGTCTTTTCGGAAAAGATGCGCGTCGGCTCGGTGATCCGCG
CTTCGGTCTCGGGACACTGCGCTTGGACGTCGTGGAAGAGCTTGGCGAGGTTCTCGACGTCGATTGTTTCCTTGTCGACGTGCGCGCCAATCTTCTTCAT
GTAGTGGAAAAAGTGCGATGTTTGTTCTTGGAGGAGCTGGTTGGCCGCGCGGTCGTGTTCGAGCTTGCGCATCAAGTCCTTGATTTTCTTGAGTGCTTCG
AGCCCATCGACGTCGTTGCTCGGGATGTCCGCCTACCAATGATGGATGCCATTTTCCAACACTTCCACCCATGGCCATCTCGACGTACTTTGAGCTCCTT
GAGGACACGCTTGAAATCACCGGCACGTTTGGTGGTGTCGGTGTACAGCTTTCGGATCAAGTCGCTCGAGTTGAAGTCGTCTTCTCGCGCGATCGACGGC
ACGCATCGAATCGTCATTTCGTCGCTGGGGGGTTGGAACGTGCATGCGAACGGGGACCCGCGAATGGGCCCGGCAACGCCATCGAACGTCCCTTCGAACG
TGATGGAGAGAGTATACTTGCCCGGGGCTGGCGGGACAAATGTCACGATGTACCGGCCGTCGCCCTTGTCGTGGATGGTCGTGATGTCCATTTGTAGTCT
GTCCGATTCCTTTGCTTCGACCAACTGGATCGTAAAGACGTCGCCGCCGCAGTCGCGCGGGACACCGTCCTTGTCCATGGCCTGGAGGATAAACGACGTT
GGCTCTTGGGCCATCACGAGGTGCGACAGCGACATCATCAAGCACGGCCCAAACCCGAGACTCTTGGCGGCGTTCGTGACGCTATGGAACTGGACGCGAG
CGATGAGAGAGAGAAAAGATGCATCGTGTGTCGATTGACCCACCTTGTACGACGTGCTGATGTTTGTAAACGATTCGCCAGGCAAGGCGACGCGAACTTC
GGTTTGGAGAGGGCCGTACTTGTCAAAGTTGGGCGTCGTGACTTGAATGGCGGTGGGGGACACCACTTGCCCTTGGACGTCGACGAATCCTTTGGAGACG
GCGAACCGGACATTGGCATTGCTTCCAGTGAAGTTGTAGCCTTCGACCTTGACTCGGGTGTTGCCTGTGATCGGCCCCGACGCTGGCACGATGGCCGACA
CCGAGTACGGCGGCCCGACGATTTCATTCACGTGGAGGCAGTGCAAGTCGCCAAACCATCGGTTTGCCCACCCCCCAAAGAGAAGCACTTTGTAACCTAC
GGGGTCGTACACCAATGCCGTGTCCGCTCGTGGCAACGGCGAGTCGCCTTTTACCGGCGGCTGCCGCCATTGCATCAACCCTGTGTCGAGCACAGACACA
TGATTCAAGTACGTGCCCTGCATGTCACAACGAGCAAGGGTCAGGGTACAACGGAGCGCTCGCGACAACGCACCTGGGAATTGCCCGACTCGTTCAAGTC
ACCCGAGTTGCCGCCAAACATAAAGATCTTCCAGTTTGGCACGGCTTGGACGCTAGCCATGACATGAACGGACGATCGACGAACGAACGATCGTGCAAGT
GTACCCGACACAAGAGTGATTCCACGTCGGCACGGGCAACTTTGCATCGGGCGCGCTCCATGAGTTGGTCGTCAAGTCGAGCACAAACAAGTCGTGAAAC
TGCTTCACCGAATTCCATCCGCCGATGACAAACAGCTTATTCTGAATCAAGCACGTCTGGTGGCTCGACCGCGGCTCGGGCTTCTCGCCCTCGGTCAAGA
TTTCTTCCCACTTCCACGTCCTCAAGTCCAACGCGTGGACGTCGTTGAAGTCGGTGCGGCCGTACCCATTGCCGCCGTACCCCCCGAACACGACCATTTT
GTGGTCGACCAACGTTGCCGAGTGTGAACCGCGACACTGCGGCAATCCTTCCCAAAAGTTTTGCGGGTGTTGCTGTTCCCATAGCTTGGTGTCGCAGTCG
AAGACCCACAGGTCGTTCATGCGCTTCTCGGCGGCGAACCCGCCAAAGATGACGAGCTTCTTGTCATTGTAGAGCAGCGCCGAGTGCCGCCACCGGGCGG
GCGGGGTGTCCTCCGGCGCCGACGACACGGGGACGATTCGAGACCAATTGAACCCGCCGTTCATGTCAAGCTTAAACAGGTCGTTGCTTGGGCCGGGGGG
AACTTTGTGGTCGCATCCTGCACAACAACACCAGAACCAATAAAACACACGCTACATCCTCGACAAGGTCGGTACCGCCAAACAGATATAGTGTGTTTTC
GGACCCGCGCAGCGTCAGGGTATGCCCTGATCGCTTGTTGGGGACTTCGCCAGTGCACTTGGGACTCGCCCAAGACATCTCTGGCTCGGCACCATACCCG
ATCGGCT