Description :
From Genome Similarity Track
Location :
Scaffold_70:60233- 62348
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_70-snap-gene-0.40Aspartate aminotransferase

Sequence
2115 bases(100 bases per row)
ATGGAGGAGGCGATCGCCGCCGTCACGGGCGGCCTCATGTCCGTGCGGGAGGCCGCGCGCAAGCACGGCGTGGCGCGCACGACGCTCCAGCGCAAGCTCT
CGCGGACGCCCGGCGCGTTGCCGTCCGCGGAGGCCCACGCGGCCGCGGCAGGCGATGAAGTAGGCGGCGCAGGTGTAAAAGTCGTGGTGGTAAAGAGCGA
GGTCGGCCACAGTCCGCCCGCCAGCGACAGCGGCAACAGCCCGAGCGACGTGGACAGCGCGCCGACGACCAGTCTGCGACGCAAGCGGCCGGCCGCGGCG
ATGGACTCGCCGGCTTCGAAAGGTTTGTCGTCTTGAAGGTTCGAGCACACCGATTGTTGGCGAGCTGGTGGTGATTGACGGCTGGTGGCAGGACCGCGGC
GAGCCATCAACTGCAAGATCCGCATGCTGTGCGCATCCGCGGGTTCGGCGCTTGACGAGCTGAGCAATGAGATGATTCTGGAGGGCAAGTGCATCTACAA
GCTCGGACTCGGCCAGTCTCCCTTCCCGATCCCGCAGTGCATCGTCGACGAACTCCGGTATGTTGAAGCTTAGAGGTGGCATTCCTTCATCAGGTGCTGA
ACGTGAGCTGGCTGTGTGCGCAGAGCCAACGCGCATCAGCGCGACTACTTGCCGGTGGCGGGTCTGCCGGCGCTGAGAGAAGACATTGCGGCGTGGGGAT
CCAAGCGCCTGCACATCGACTACTCCAAGGACGACGTGCTTGTGGGTCCAGGCACCAAGGAGCTGCTCTTCGTTCTGCAAACCGTGTACTACGGCGACCT
GTTGTTGCCGAACCCGAGCTGCACGAGCTACGCGCCGCAAGCGAACATTGCCGGGAGGTCGATGATCGCTGGCAGCTGGACTTTGTGAGCGTACCGGTAC
TGATTATCCTTGTTGATGCTGCAGAAACATGATTTGGCTGCCCACGTTCGCTGAAGATCACTGGGTGCTGCGACCTGAGGTGCTCGAGGAGCTGTGCGAG
AAGGATCCAGGTTGGTCGCCATTGTTCCGAGATCCGTCCATTTGAGGACAGGCTGACGAGAGTGCTTGTGGTAGATGCACCGCGCATCCTCATCCTCAAC
AGCCCGTCCAACCCCACAGGATGCGCGTACCACGACGACGAGGTGCGCTTGGCGTTGAGCTCGCTCCGATCGGGACGAGTACAGAGCTGATGGATGCCTT
GGTTGTGAAGCTGGAAGCTGTGGCAGAGGTCGCGCGCAAGTACCGCGTGCTGGTCATCTCGGACGAGATCTACTCGGAGCTGCACCACACGGGCGAGCAC
TTGTCCATCTCCAAGTACTACCCGGAGGGGACGATCGTGTCGGGAGGGCTGAGCAAGTGGTGCGGCGCTGGTGGATGGCGCATGGGCTTCTGGCTCTTCC
CGCCGAGCATGCAGTGGCTCCGTAAGAGCATGCTTGTGATGGCTTCCGAGACGTACACGTCCGTCGCGTCGCCGATCCAGTACGCAGCTCGACGCGCGTT
CGTCCCCGAGTACGTTGGTGTTTTCCGCTGCTGCCTCGACAGGTTTCCAGTGACTGACGATCTCCTGTACCAGTTGCATCGAGATCTCGTCGTACCAGGC
GAAGTGCCGACGGATCCTCAAGCTCATCGGGCGGTGGTGCGTGTACCAGCTGCAGAAGATGGACGTCGAGGTGCAGCTCCCCGAGGGCGGCTTCTACATC
TTCCCGAGCTTTGCGCGCCACCGGAAGGCGCTCTCGGACCGCGGGCTCACGACCGACGCGCTTCTCTGCTCGCGCCTGCTGCAGGACACTGGCGTGGCCA
TCCTGCCGGGCTCGTGCTTCGGTCGGCGGCCCGACGAGCTCTTTGTGCGGCTCGCGTTCGTCGACTTCAAGGGCGAGATCGCGCTCTACCTCGTCGAGAG
CATGGTATGCCTCGATGATGTTGTCGGTAGACATCAGCATTGCAGTCGAGCTAACAGCGTCTCTGAACAGCAGGATGATCTGGAGCTCGACGCCATCGAG
GGCTTCATCAAGTCGGTGTGTCCGAACCTGGACATTGCCATGCGCAAGCTCGCGGCGTGGATCTCATGTGGGGCGGTGCGGCCATCGGCTGCCGTCGCTC
TGGGTGGCGCGCCGT