Description :
From Genome Similarity Track
Location :
Scaffold_759:6023- 7460
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_759-snap-gene-0.6GJ15230

Sequence
1437 bases(100 bases per row)
CGCCTAGAGCTGGGAGCTCTTCAGTTTCGGATTGGGCAGTTTGAGCCGCCACAATCTCTGCCTCCGGGCTCGCTAGTCCTTGGAGTGGAAGCTTGTCGGC
GTCGGGCTGCTTTTCCTCGGGGCTTTCAACTTGTTCTTCAGCAGGCGAGGCGCTGATCCGAGAAAGTGGTGAAATTGGTTTCAGCCCATCGAGACTTCGC
CTTCGAAGGTCAGTGGCAGGAGCTTCCAATGCCACATTCGGAAGCTTCGCACGCTGAGACGCTGGGTCAGGAGTGGAATTTTCGTCGCGTGCTGGGATCA
ATAGTCGTGGTAGTGGTGTTCTTGGGGAAGCAGGAAGCGGTCGATCGTTTGTGCTTTCATCGGCCCAACAGGCTTGACGAGGCGAAAGACGAGCGGAAGC
TGGTTCGGTGGTATAAGGTGGCGCTTGCTCGTCCCCAACCCCATCCGCATAGTCGAACTCATTGTTCGTCTCAGCGTCGTCGCTCGCTTCTACGGTGACG
TCTTGATCGTGAGAAGAGCGTTCACCTTCAGGCCCCAGTGACTCTTCCTCGTGAATCTCGATCGTCTTTTCACTTCGCAGTCGGGCTGATCGTGAGCTCA
TAGCAGCACTAGGACTACCAACAGCCCTGTGGGTTGCCTGCAAGTCCGCGTTCTCCACTGGTAGCGTGGTGTCGAGCGTGAGTGCGTAGATTCCCAGTGC
TCTGCTCGTCTTCACCGCAGGCTCCATACTCGCGATCTGCTCGTCTCGATCAACAGCGGACTCGCCAGGCTCATCATGAACATTCGTCGGACTTGCAGAA
GCAGAACCCGTCTTTCCACCACCTTCACCGACGATAAACCGCCGAGTCGTGAGAAACAACTCGGTGCTCACTGAGTCACCCGTGCCCTGGACGTCGTGTA
GAGCAAGCTGCGACACACGAGGCGACGCCGAATCTTCAACAGCGAACACTGTCAACGCCACCGATAATGGCGATCGCTCAGCCTCAACTGGTATACGCTC
TGATCCCTGAAGCTCTGGCGCTGAAACTGACGGCGCGAGAAGCGCCGAGGTATTGCTAATCAGCTCCTCCATGCTCTTCTCCTTGGCAATCGAGTGCCTT
TTCGATCCGGCCTTGCTGACAGATCGTCTGCGCAGCGTGCCATCCTGATCTCTTTCCTGTGAACTGCGTCGCGCATTCTCCTGCATGCGCAGCTTCTCAA
GCCGCTTGACGTCTTCGGATCGAGGCGAACCCAGCAGCAGCGACCCGCGCTGACTGGGGCGCTCCGTGGTGATCTCGACACCCATGCCCGGGATCTCATT
GAAGATGCTCTCGGTCTTGAGCACGCGCCGCTCGTTCGTGTCCGATCGTTTGCGCAGAAACTGCTCGGGCTCCTGCGGCTGCTGCTCCTGCAGGAGCGAT
GACTTTCGAGTCCCTGAGCGCGACGGCGAGAGCTCAA