Description :
From Genome Similarity Track
Location :
Scaffold_24:60226- 63888
Transcript NameFunction/comments
Phyra_77346formin-homology 2 domain-containing protein

Sequence
3662 bases(100 bases per row)
GCCAGACGACGCGTTCGCGCGCGAGCCCGATTGCGGCGTGTGCTCCAAGTCCTTCAACATCCTGCGACGCCGCCACCACTGCCGAAGCTGCCACATCGCC
GTGTGCAAGGAGTGCGGGCGCAAGGCCGTCGACCGCAAGAAGCCCGTGCGCTCGCGGCCGCAGTGGTATTGCCTGGGATGCCTGGACGACGACGCCACGC
TCGAGATCACCGGCTCGCGGCCCACGGCGAGCAAGCGCCGGAGCTTCTCAACGTCTTCGTCGTCGTTCGCGCCCACGAACGCGCCGCAGGTCACTAATGT
GAGTGTGGATTTGTGCAAGTTGAAGTGCCTGTTTTTGACGGATTCTAACGGTTTTGTGCCCTCTGACAAATTGGTGCGGACTAGTTGACCAGCACGGCCA
AGTTCTGCATCGAGTGCGGCTATGAACTGCCGCTACGCGTCAAGTTCTGCATTGAGTGCGGCACGTCTGTGCGGCAGCAGGTGATGTCACCGGTGAGTGT
GGACGGCGTTGGCGCTGCAGAAATAGACAGAGGCAATCGCGGCTTCCGCGACTCACTGGGGACGAACCTCCTGGTCATTGACGAGCACAGTGGGTCGCCG
ACGGAGCCGACGGACGGATCAGAAGACGATGCGCCGGTTGAACAGGAGCCCGAGGATCACGATCCGGTGGAGAAAAAAGTGGAAGTGGCGGCACCTGAAG
GGGACGAATATACAGCTGCAAAGACCAAGGAGTATGAGGAGCTTGTGGCGCAATTGCAGGCGGAGAACGAGAAGCTGCGAACTCGTGTGGAGAAATTTAA
GCATAAGATCTCCGAAGCAGAGCGTCGTCGGCAAGAAAGAGAGGAGGAGCACGCTCGCGCAGTGTCAGAGGCAACTGCAGCTGCAACGGCTGCTGCGGAA
GCCCAGGCTAACAATCGCAGTGCATTGGGCCCGGCAACTCAGGCGGCATCAGTACCCGAAGCGGTAGGACCTACTAGCAATGGAACGGGTGTTGCTGCGA
AAGACCACCCGGACTACTTGAAGTTTTTCAAACTTCTGAAGATGGGTCTACCTGATGAACAGGTAAAACTGAAGATGGAGGCGTCGGGCGTTGATCCTTC
GGTCCTCGATGACCCAGATGCGATTATTGGAGGTGCCGCACCAAGTGTTGATAGTGCACCAGCTGCTCCTGTATCGAGTGGTGGTGCCCTGGTGAAAGAT
GACGAGCAGTATGCTAAGTTTTTCAAGCTTCTGAAGATGGGGATGCCTGCTGAACAGATCAAGCTGAAAATGACCGCTGGTGGTTTGAATCCGGACTTGC
TTGATACGCCGGATGCACCAATGCCCGGTTCCGCGGGCGCTATCGCACCAGCGGCAGCATCTAACCAGGTGATGAGCGTGAAAGAAGATCCAGCTTACGA
GAAATTCTTTAAACTGGTGAAGATGGGTATGCCTGCCGAGCAAGTAAAAATGAAGATGATCGCCGCGGGCTTGAATGCGGACTTGTTGGACACGCCAGAT
GCGCCGTCACCCAACCAGAAGTCAGCTGGCAGTAGTGCTGGCGGCGGTCTTCTTTCAGGACTCCCTCCTCCAACGGAAGCGGTGAAGGTGGACCCATCGG
CTTTGAAAGCAAGTTTAGCCTCAAAATTAAACAACAAAGCAGCACCCAAGAAGCCCGAGGAGCCTCAGCTGCCGAAGAAGGAAACCGTGAAGCCGAATGT
TGAATTGCGCCCGCTGTTCTGGACCCGCGTGCCTGTAAATGTAGTTAGCAGCACTGTGTGGATGAAACTGAACGACTCGCATGCCGAGATGGACGTGGAC
GAGATGGAGTGGATGTTCCGTAAAAACCCGGTGGACGCGTCGAAAAAGATTGATGAAAAGAAGAAAGAAGCGGAGAAGGTACTGGCACAGCCCAAGGAAG
TACTTTTGTTTGACCCGAAGAGACAGCAAAATGTGTCCATCGCCATTGCTCGGTTTAAGATGTCATCAGAGGATATCAAGAACGCAATTTATGCTTTGGA
CGGGCAGAAACTGGGGTCTGAAGTGCTGAACGTGCTCATTTCTATCTCTCCTACGCTGGAAGAGATTGACATGCTCAAGAATTACGATGGAGATGTAAAG
CTGCTAGGAAATGTTGAGAAGTTCTTCCTTGATTTGCTGACCATTCCGCGCTATACTCAGCGTATCAAGTGCTTCAGGTACAAGTTACAGTTCGAGAATC
GCATCCTCGAAACCCAGGCACAGCTGGATACATTGGTTGCTGCTACGGACCAAGTGGCTGAAAGTGACAAGTTCCGCCGCGTTCTGGAGCACATTTTGGC
GATCGGCAACTATTTGAATGGTAGCACTCCTCGTGGTGGCGCGTATGGCTTTAAGCTGGACACTCTTATGAAACTGCACACGCTGAAGTCGGTTGATCCT
CGTGTTACCTTAATGCACTTCCTGTTGCGTCAGCTGGAAGAGAAGTCTCCTGATGTCATTACTTTCGCTGGAGAAGTTCCCCATATTGTGGAAGCGAAGA
GACTGTCTCTTGATCAACTACGCGCCGATCTGTCGTCCTACAACACCGAGCTAGCTATGCTGAAGGGCCAAGTGCGTGCGTCCAAGAATGATCACATTGA
GGGTGACAAGTTTTACGAGGTGATGACTCCGTTTGCAAAGGATGCAGAAGAGGTACTGGAAGAGCTGGGACGCGATTTTAACGGCTTGGAAACTTGCTAT
CAAGAGCTTGTCAGCTCCTTTGGTGAAGATCCACGAAAAGTTGGCCCCATGGAATTCTTTAATATCCTGGATGAGTTTGTGACGGAGTTCAAGAAGGCTT
ACCGTCAAAATCAGACGAAGGAATATCAAACTATCTATGAGGAGGCTGCAGCGGCGCGTGCTGCTGCTGTGGCTGAGAAGGCTGAGCGATTAAAGCACGA
GGCCGAAGAACGCCAGCGGCTGGAAGAAGAACGGCAGCAAAACTCGCAGGAGACCAAGGCGATTTATGCCGAAATTATGTCCATCATCACCGCCTGGGCT
GGGAAGCATTCGCCAGGTAACGAAGACGCAGTGATCGAGCAGTTTAAGGAATCATCGCGGAAGTTTGGCTTGGATGAGATCACAGCTGATGAGTTTTGTG
ACCAAGTGCGCCAGTGCGTTGGGTCGAAAACGGCAGGTAAAATTATTCCAAACAGTGCGAAGCTTCTGTCCGACGAAGAGAAGCAGAGTGTGCTGCTAGA
GGCGTTTGCTCGATTCAAGGGGCAAGTGAAGAAAGAGAAGGAGTCGAAGAAACAACAACGCAATTCATTGGTGTCCCCACCGTCCGAAGGGCGCGAGAGG
GCGGGGTCCTCATCGGCGGGTCGCAGACGCAACAAGGTCACGGTCCCGCTTCCGATAAAGGACATCGAGCCTGTGGTCGGAGAAGAGGCCCAGCTGCTTC
ACAAGTCCATCTTGGAATCTGTGCTGGCGGCGTTTGGTGGCGATCCAAAGAAAATGAAGTCGTTCACGTCCCATACTCGCAAGTATGGCAACGAGCAGAT
CACGGCGCACGAGTTCTACCAGTATTTAATGGAATCGTTCGATCCTGACTTTGTTGGACGCCTGGTGCCCGACCTCGCGCGTCTGCTGCAGGATTCGGAG
AAACGCCACGCACTCATTCGAGCATTGTGTGAAAGTGCGCCGGGCTGGGCAAAGTTCGCGGG