Description :
From Genome Similarity Track
Location :
Scaffold_98:60213- 62239
Transcript NameFunction/comments
Phypa_INRA-310PPTG_18989inositol-3,4-bisphosphate 4-phosphatase

Sequence
2026 bases(100 bases per row)
GTTAAGATTAGTCGCCATGAACGCTGTCGCCTTGTCCTTCTTCATGTTGCTACGTTTCAGACACCCAGTGATGCCCTGTTCCCGTCCATCTTCGAGCGAT
GCAAACATAGTCTCGTATCGCTTGAGACTTTCTTGATACGAGGCGTGAAGACGCATGTAATGAGCCATTTCGAGTTCCACGTCGCGCTTCCGCTCTTCCA
CCTCTTGAACTCGAGTACTAGAGGAGTTAGTGCCTGAGTTCGCGTGAATATGCAGCTTCATATCGTTGATAACTGTGCGAGCGTCTTCGATGCGTTGGAC
ATTTCGGCGCTGGAGATGCTTGAGATAAGCGACAGTCATCGAAACGGAGACGTAAGACGCCGATAATTCCTCAGACACAAGCACATGGCTGGCCGTCGAT
GAGTTCATCTGACCACGGAGCATCTCGCTATAGCTCAAGCCACCCCTCAAGCTCATGGTAGAGCTAGCCATGATATCACCGGACTTGCGCTTCTCCATTG
CCTGTGTGTCCACCAAGAAATGGTGCTTGGCATACGTATATGCATGGCTCACATTGATACTGTGACTGGGTGGAAGAAACCGATCCAGAATAATATAGTA
AAGCTGTTTGGATGCATCTGTTCGATGACATTCAAGCAGCATCGAAGACTCCCTCGAGAACAGAACATCCAGAGCCGAAACTCGCACAAACCCGAGCGAT
TTTTGGTTCTCCAGCGACTCTGAAGAAGGGTTCACCACTGAGAAAACTTCAACCTGCAGCATTGAGCGTGCTGAACGTGGAACAGATAGCAAGGCATTGA
AATCACGTGCGTAAAAGTCTCCACCACACGATCGAAGCGACAGCGAGCTCCGTATCTCCGTCCGTGAGATCTCCTCTGGTCGTTGTCCTTGGCGGATATT
GAACAAAACCACCAGCATCTGAGGCACATCCTGAACAGCCTTGCTGCCAATGGAAACAGCCAACTCCACACTTGGACGAGGCTTGAAACCAGGTAAACTG
AGACTTGGAGCACGAGGAGAATTGGACGGAATTTGCGTCACTTGGATCTCACTCTCTGAATGGGCTGGAGAGTGCATCGTTGACAGTCCATTGTCGTCAT
ATGCACGAGGCGCAACGGTAAACGACGCAGACTGCGTGAGAATGGACCCGGCGCTTGAAGACCGGTACAGTCGGGGTTTAGTCTTGGTCGCATCCAAGCG
AGCAGAGGCTGTGCTAGCCAGATGAGAGCTTTGCTGCTGTCTGGACTTCTTCGTCTTCTGTTTTTGCTTTTCCTCGTTCTCTCGCACAGATCGGGAGTCG
TTGGCAGCTTGTTGGATCACAGTCGAGTCCGTCGAGAAGCGCTTCATAGCGTTCATGCCACTGGCGATATGCGGACTCTCCATACGTGAGAAACTAGCAC
GATCCACATTGAGATCGTCTAGCATGGGTGTACTCTCCGAGATACGAGCTTGGAGCTCCGTACGGAACGATCCGCCTTCCGTTCGGCGGTCAAACGACCC
ATTCATCGTCGCACGAGATGTCGATCTCACACGTTGCGTGATGCAGCCGTTGATACACGAGATCCAGGCCTCCATGCTCTCCTCTCCTTGCTCTGCGAAC
AGCGTGAGCTTGCGTCCTTCGTTCTCAATGGTGAATCTGAATGGGAACCCGTCTTTTGGAGTGGGCTGCACTCTCGTGTTCTCATCGATTGCGATCTCTC
CCAGCTTGGCAAGCTCCTCAGCTGACGTGTAGTAGCAGAGCACAGGGCGGTCACGTCTCAAGATGAAGAAGCGGCGTCTCCACGACTTCCAGAACGAGCC
CTGCTTGACCAAATAGCCGCTAGTGATGATGTCAGCGTCTGAGAACTGCTCCACGTCGTTGCCACTCATGTGCACCGTCCTGTTCTTTTGATACGCACGC
TTGCGCAGTCTGGCCATGGCTTTACTACCGTCATGCGCGTGGTAGAATTGATCCTCGAAGCGCCCGCTCTCCGACACTTTAAGCTTGGGTTTCATGCGCT
CCGTCATGTCTGAGAGACGCGATGGG