Description :
From Genome Similarity Track
Location :
Scaffold_151:60213- 62083
Sequence
1870 bases(100 bases per row)
TACCTATAAATACATTCACCTTACAACTTACCTTAAATTGGTCACTTCGCTTCCTTAGACAAAAGGGACCTGTGAACTACTGTTCACGGAGTAGTCTCGG
AAGCCAGCTTGCTCTAGCGCAAGGTGCTGTGTGACCCTGTCACACTTGGTAGCACTTGTAGTCAATCCACGCCTACGCGGGTAGACTACCTGAACCTCTC
TGAAGTTCGTCGCGGAACGTCTTTTTCGCATCCGAACGACTCAATGTTCGCGTCGATTCGAAAGAAGGCTGGTATCATCGAGATGGTGGCCCTGCAGAGC
CTGGTTGCGTCAACACCGGCCTAGCAGCTTGGGCTCGTCAATGCGTTTGACGCCTAAGAGCGAGTGGCCCATCGCACATGTGCGCGAAGACCTGCAGGCT
CCGGCGGCGGAAACAAGTTTTCCACACCCGAAGCTAATACGGTTGAAGGTGAAGCCGTATGAAGGGAAGAGAGGTCACTTCTGGGTTCGAAAGGGAGAAA
TTGCGATTAACGCAGCTCCGACTTCGCCCGAGCAACTCCACCCTGATGTTCCGCTCTCCAAACTTAGCGGTCGTGCTAAGTGTTGGGCGTACACACGGGA
GGCGACATCGCCTGGACGTTTCATATACTGAGCTCAGCTGAGCGAACGGCCCTAAGCCGCGTTCCTCCCTCCAAACTACGATTACCGGCATCGTTCCTGC
TTCCTCTCATGCAAGCAAGAAAAGACGCAAGCCGCCCGAGTACGTCCAAGAGCTGCGGAAGCTCCAGGCGTCCCTACTGGGCAACTCACTCAGCGAACAC
ATCAAAATGGCTGTGTTCATGGACGACCTTCGAGTGGGCCCGGCGCGCACTTAGCCGTTCTGGGTGCAGTCAAGCACCCTCGAATAGGCTATTCAAGTGG
CGCTTCAAGAAGCAAACAGCCCTCGCCAGGCGCGCACGCGGGCCTCAACATGACCAGGGAATGCTATGCTGAACCCAGGTCGGTCCAACCTCGCAGGACC
AGTTCCCATGGAACTCGGGTCCAGAGAAAAGTGCGACATTCGATGCTTCAGCTGCGAGAAGCTGGGACACTTCAATCGTGACTATTCCGCGTAGAGACAC
CGCAGGCGGATTTTCCCCAAGCCGTCCTCAATCGTCGCTGGTAGAAGCCAGGATCCCGGCGACAGGCGAACGCCGGAGAGCGGTAGGGGCGGGGCGCCCT
ACTGGGGAAGAACTAAGCCTTCGTGAGGGGTGCGCGGGTGGCGCGTACCGCGGGGACTTAGCCCCTGAGAGTCTTCGCACTCTTGAATCGGCGAAGAGCA
GCAGTGGCTGCTTGTAGTACACGGATGTGTACGGGGATACGATCACTCCTTAAGAACCTGGATCGATTCTGGGGCGTCGCAGAATTTCGCACGCCGCCAG
GCGGTTGATCGTAATAGCAAGAAGATGTCTTATACTTTGCGATAAAGGCAACGGGACGGAGTTAGTGCGACCGGCCTACGGGAAGGTCGTCACTGTCCCC
AACTTTCAAATGAATCTAGCCGTCAAGCGCGAAGTCTTCGACAGCCCCGAACAGTTAACTGCTCACGACATGAAACCCTACGATTGGATTCTGGGCATAC
ACTGGCTCGAGAAGCACGATACCTGGATCGACTGGCGAGGCTAGGCAATCGGTGTCAGCCGCCCTGCGATGTCCGACAGAGCATAGGTGAATCATGTTCC
CACCTCTGTCAGGATGCCGAAGCATCCGGCGGATGCTTGGGAGTCGTCGACGTATATGACGAGATAACTGATGGCTGAGGAAAATTTGAAGGTGACGGCG
CCAAGAGGCGCTGGCCAAGCGGGTAACGTAGGTCCACAAGCGGGCAACATAGCTCCGCAGACAGCGGCGG