Description :
From Genome Similarity Track
Location :
Scaffold_41:60201- 76482
Transcript NameFunction/comments
Phypl_g1580hypothetical protein PHYSODRAFT_468947
Phypl_g1581hypothetical protein
Phypl_g1582hypothetical protein PHYSODRAFT_248374
Phypl_g1583hypothetical protein
Phypl_g158460S ribosomal protein L17-2
Phypl_g1585hypothetical protein PITG_03352

Sequence
16281 bases(100 bases per row)
TCCGTTTTGAGGAGCGGCCGGGGCATCGAAAGAAATGTCGAGCAAGTCCATTTCAACCttcggcagctgctgctgcgggggCGGTGCTTGCTCCACAGGG
GTCGGAGCTTGGggtggttgctgctgcggctgttCATTGCGGTTCGATGGGCGGCGCGAAGACGAGCGACCAGAACGGCGGCTAGAGTTGAGAGTTGCGC
GGGTACTGGATCCAACACGGCGAGCACCAGGGATCGGGGCCGGGGCGCCGGGAATGCCGCCAAAGATGGCGGAAGCCAGAATCTGGCGttcgtcgacgct
gccgttggcttcgtcctcgctcgagGGCTCACCATTATCGTAGTTGTTTGGAGGAGCACCGTACTCCTGCTGgggcggctgctgcggaggCTGGGCGCCG
TAAGCTCCCTGGCCACCATAGGCTGGGGGAGGTTGAGCGCCATAGCCAGCTTGTCCGCCGTAGGGACCCTGGCCGCCCATGCCGCCCTGGTTGTACGGGT
CAGACGGATAGCCAGCAGGggcaccagctccaggagctccaggtgcAGCATTGTCGGGCGTGTTGAGACCAGTAGGACCCCAGACATTCTTGACCACTCC
ACGCTTTCCAGCGCCGAAACCTCCGGTAGGATCGGGGCCACCCGAGCTACCCAATCCGGGCATACCGCCCTGGGCACCGTTGCCACCCCACTTATTGACT
CCAAAGGCACCCTGCTGGTCCGCAGGAGGAAGTTTGGTTGGGTACGGGATCTCGGGCTTCTTGTATGCCTCAAAGTTCAGGCGGTTCGAGTCCCCACCGT
TGCGACGGTGGCCATAgccctcgtcctcgtcgtccgagtcctcAGGTGGGTCGTACAGCGGCGCTCCCTGAGCCGCGGCCTTCTCTACAAAGCTCGTAAG
GAAGGGAAGGTCGGGGTCAACCTCAATGTCCTCGCAGCTAGCATCCTCCGGGAAGACCTCATTCATGAGCGAGAAGTCCTTCGATAGCGCAAGGTACTcg
aagcagcgctgctgTAGGTccgtgctgcggctggtCTTGTACTTGTCCATCATGGCATCGGCTACATCAATAGTGTGTCCCATCTGAGCGGTAATCTTCG
TCACAGCCGAAAGCACGTAGCCACGAGTAGTGTCTTCCTGATCGAACGGGCGGTCGACAAGCTCCACAAGGCGCTCGCagatctcctccagctccatggc
gtccGACAGATAGCCGTACTCGCCGAGGACCCAGGCCATGGTGCAGACCAGGATGTCCGGCAGCACGGGGCGTTCCAGCAGTTCAAGGTAAGTATCAACA
GCGTCACGACGCAGCTCCATATCTTGgtcctcgtcttctccgcTGCCCTCAGCAATCAGGCGCAGTAAGTTGTGCGCCACCTCAGGGCGAACTAGGTCAC
CGCCCAGTTCAAACACATTCGTCATGGTCTGAATGTACCAGGCGTTGCTTGGGGCATAACGCTCAGCGCACTGCGTGATACGCGACACCAGTTCCGTGCG
GAGGAAAACATCCGAAGCTTCACGAAGAAACTGAGTGAGCTTGTCCGAAATGAACTCAACGTTCACGGGGTTCGTCATGCGGTACAGGAgatccagcgtc
ttgcgcttgagTGTCTCATCCGGATCCTCAAGACAGTCAATGACGGCCATTTGGTGCGCCGCAGCGTACCGCGGATGGTCCTTCACGATAGCAGCAAGCC
CCGTGACACCCAGGTACTTGAGGTTGTGGTTGTCGCTCGAGATGAAACGCGAAATGCTagcagccgcagcatctAACAGCGTGCTGTTCGGATAgatcgt
cgtcaccgtctGCACGCACTCGTAGATGATAGCGTAGCCCACATTGATGCCAGTGTCAGCACGACGCATAACATCGTGTAGCACCTCGTACATGCCCTCA
CTGGTCTGCTGGTCAGCCTGACCCAGCAGTGCCAGGATCTTCAGCAGGCGGATCTGGATCCACGGCGCCGGAATGCGGTGGTAGTCGAACTCACGCGGCA
GTCGGTGCTCCGTGATCTGCTTGAGGATGCTGACAAAGCTGGGCACAAGGTCCTTGTAGTCCGTGGGGGTGGCTTCGGTCAGGTCGTGCAGGATGCAGAG
CGTGGTGCCCATCACACTGGGGTCGCGGTCACACAGCGTGCGACGCAGCGCGTCTCCCGTGTCGCTGACCGAGTCCGGGTTGAGCTGGTGGAAGCGGTGG
ATCGCCatcaccgccttcttgcggacgagctcggcgtcgtggcgcagcaggtcaAGGATCATTGGCTGCACGGCCGGCACCATCTCCACGGTTACGAGCT
TGCAGACCGCCATGAGGGCGGCGCAGACTTCCAGGTGGTTGGAACTCTGCAGgtctcgctgcagctggttgATGATCATGAAGCGGAACTCGTGCGTGGG
GGACAGGCAGAGGCTGCACGTGAGGTAGCCCACGCGCTTCTGCATGAGgttggtgctggccgtcATCTCCACAGCCTTGATGTAGCCAAAGGACGCGTCG
TGgcccagcatctccacgtaCATGAGGCGGATGAGGAactcgcgcttgcgcttgttcacgaggctgctggacgtgctggaggtggccgtCACCTCGctca
gcttgcgcttgagctgcgccacctcaTGGATGATGATGcggtcctcctcctgcttcgaCTTGCTCTCGCCGATCGACTTGACCAGCTCGAAGAACTCCTT
GGACAGGTGCCCGCCCGACATGGTGCCGCCGGTAGATGACGTGGACGACGATCTCGGATTGAGGGGGTGTAGTGTGGTTGTACCGGTATTGGCTACCGGC
CCAGCACGAACTACTCTCTTCAGAAATGAAGAGGTACTTAACCATTAACTGCAATTTAGTATGTATTGGGGCTGGTCCGATAGCGATAATAAGACGTAGT
GTAGTCTACCGGTATCACTGCGCGAAACATGGTGGAGGGTGTGGAGCTCTCCGACGCCGTGGTGCGCTCCTACAGCGTGGCACGCAACTTCGCCCCGCAG
GTAGGACGCACCTACTGCTGTAGATGCGTATCCTTTCGCGTGCTTGGCCCTGTTGTACTGACGCTAACGTTCACCAACTGcacaggaggaggaagagtCG
AACGTTCAGGtgacgtcgctggacttcCACCGCAACGGCGAACGGTGCATCACGAGTCGCAGCGATGGCGTCATGTCCATGATCAACTGCATGAGCGGAA
CGTAAGTTGCATGCATGCACCTGTACCGATGCTATCTGTGCTGGGCCAGGGCTGACACGTAGCAATTGCTGTCGACAGGGTTGCCAAGACGATCTTGACC
AAGCGCTACGGTGTTGGCATTGTGAGATTCACGCATCACCCGGACTGCGTGATCTTCTCGTCAGCTAATAACGCTAACGACCGTACGTAtcacgtcgtgc
tgctgctttcttACTGATCGACTGGAGGTGCTGTGTGTTGACCGCGTTGTGTCTGTTGGTGGGTGTATTTTGTTTAGATCGCATCCGGTATCATTCGTTC
TTCGACAACAAGTTTCTTCGCTACTACACTGGCCACACCGATAGGTGAGTCAGCTTGATGTGATAAACTGCTTCGGTGATGCGCGCATGATAATGCTAAA
CTCCTCTGATTTATGGTGGTAGAGTCACGTCGTTAATGATGCACCCCACTGCAGACCAGTTCCTTTCCGCTGGAATGGACGGCGCAATTCGGCTGTGGGA
TATCCGCAGTTCCGACACTTCCGTGCGTCATGTTTTACACGTGAATATCACCCTGGTCTAAGCTAACAGGTGTCATTTTGTTTACTTCTAGGCTATCATT
CGGACCGACCACTTGCCAGTCTCACACATCTGCGCTGCGTACGACCAGGAGGGTGTGGTGTTTGGCGTGTACACGGACGACCACTTGATCCGCATGTACG
ATGCGAGAAACTATCAGGAAGGGCCTTTCGCCAAGTTCTCGCTTTATGATTCGTCAGTTGTGGCAGCGGTGGAGCCGTTCCTCGCGCATATGCAGGCCCC
GAACTTgaacgcgaagaagctccaTGCGCTCGACCTCAAGTTCAGTCCCGATGGAAATCAGCTGCTCATCACGACAAACCATGGCGTGTTCATTCACCTA
GATGCGTTTGAAGGCAAGCTGCTACATCTTTTCAAGGAACATGGGCTGACCCAGAGTCAGCGCAGCGACCCCCAGCTTGGTTGCTGCTATTCGGCTGATG
GTGCGTATGTAGTTACTGGTGCAGAGGATGGCCGAGTGTTTTTCTATAAGAGCTCTACCGGACAGTATGTGCACACCGTTCCTCAGGGTCACAACGGTCC
TGTGCTGGACTTGCAATGGAACCCAAAGCGTCACCTTCTAGCAAGTGCAGGAGGCAACTCGACTGTGTTGTGGTCGGCAGCAGGAATTTGACCACCAAGC
AGAATGAAAAACTTGTCAGGCTGCTTTGACTCACTTGTGCCGTGTTTTGCGTTTATTTGTATGTGGCACCTTGctgtgtacatgtacactggAGAAAGCT
ATGAGGTGCGTACTATTATAAATTATAATAGTACGTATAATTTATAATATAGTCGCGTTGCAGTTGTCGTCTAAGCAGGGTCTACGAATGATCTAACATC
CCAGTTCTGATAGCAACGCGTTTCACCGATATGTAACGTTTGAAAAGGTTTGAGAGCAAGCTCGCGACCTTGGTTAATTCCATTTGTACAACCGAGTCGG
TGCTTTTAACATGGGGTTCCTCGTCGGAAGTATCACCGAGGTATGTCATCGTTGTCACAGCAAGGATAAGTTATCGTGGATAAGTACGTCAGCTCTCCGA
GGGCTGGTTGTCCCAAAAAACAGTACCGGTACACGTGACATTGTCACTGACAACGGTCTCCTTCAACCATTTGCCTATGATCGAATTCATCCCCTTGCCT
TTCTAACGCCACCGAGCACATGACTATCGATACTGAAGCTCGGTCCGACGGCATCAGTACATGCATTTTGCGAGATTTATCGACGGACCCCTGTGCAATG
CTCAGTGCCGTGTCGCCGACACGGTGTCGGGCACGGAGGCACGAGTCCGATTGCGAGCCGCAAGCGTACACCGTATCCATAGGCTCAGGTGCCACCAAGC
GAAGAAGTTGAACAATAACAAAATTCGCAAAGACCACCTCATCGCAGTTTGATCCCACATCTCCACCTCGGATCTTCATCTGTTCGGACAGAACCCTTTT
GAGCCTGGCTCAACCCGTTTTCGTTGCTGGCATTCCTTTTCGGTTCCCACTATCGTTTCTGCGCCGTGCTCCAGACAAGTCAAGTCTCCGCAAGTCCATG
CTTTCAGGTCGGGCGCTCGGAGCTGCGGCTCTGGCCTATGCTTTCGTGCTTTCGCTCCCCTCGCTCGTCGCCGCGAAGGACTACACTGTCAAAGCCGATG
CAGTCACGACAGTAGTTGACACCTGGGAAGGCTGGGGCAcgtcgctctgctggtgGGCTAACGCTTTCGGAGACCGTGAAGACATTGCCGACCTATTTTT
CACGCAGAAGGATACCGTCAAGCTGAAAGGTAAATCATCCGGCCTTCCGGCGCTGGGTTTCAACATCGCTCGCTACAATGTCGGCGGCTCTAGCAAGAAC
GtcatcgacgacagcggTACCGAAATTGCGATGAAGGAGTCACCGAAGATGCCGGCATTCAAGTTCATCGAATCGTTCTGGCTGGACTGGTCCAGCAACG
ATACGACCAGCAAGAGTTGGAACTGGGATGCGGATgcgaagcagcgcaagatgCTCGAGCTGGCAACTCAGCGTGACGTCGACCTCACGGAGGCATTCTC
GAACTCGCCCCCGTGGTGGATGAACAACAACCACGCCACCGCTGGCGGAGAAAGTGGAACAAAGGATAATCTGCAGAAGTGGAACCACGGTCAGTTCGCC
TTGTACATGGCTCTCGTGGTGAAGCAGGCAAAAGAAAGCTGGGGAATCAACTTTACGTACGTGGAGCCGTTTAATGAAcccacgagctcgtggtggcaGT
ACCCGGGCGGTCAGGAAGGCTGCCACTTTGACGTGGCAACACAGGAGGACGTCttggtgaagctgcgcaCAAAGCTGGACAGCTTTGATCTGCAAGACGT
GGCCATTGCTGCGTCCGACGAAAACTCGAACACGCAGACACTCTCCACGCTCACTGCCATGTCCACGAATGCCGACGTGATGGCCACCATTGGAAAAATC
AACACCCACGGCTACGGTAACCGCGCGTCGGACCGAGCCCCcctgaaggagctggtgaagaaggtcaagaagaAATTCTGGGACTCCGAGTACGGCGAAA
AGGACGCGACGGGACTCAGCCTGGCCCAGGCTGTTGCCAATAACATCAACGAGATGGGCGTGTCGGCGTTCGTGTACTGGCAGCCCTTTGACGGTGGCGG
CTGGGGCCTCATCAACTCGGCCCCGGGGAATATGACGATTGACGCGCCCAACCCGAAGTACTACGCTCTGGCACAGTACTCGCGCCACATTCGACCCGGC
ATGACCATCCTGGCCACTGACGACTTGAATACCGTCGTGGCCTACAACGCTAAGTCCAaactgctcgtgctcgctACGGTGAACTCAGGCGACGCAGCTT
CGAAGATCACGTACGATTTGGCGAGTTTCAAGTCGGTGGCGGGCCCTGTGTCTGCTTGGACGACCGAGACGAGTGGCACGGGAGCGCTCTACAAGACATC
AAAGGTCGAATTATCTGGCACGTCGTTCAGTGCGTCGATCCCGGCCGCGTCGGTGATGACGTTCGAGGTTGAGGGCGTTGCTATGTAAATCTCTCGTCGG
CTGCTTTGCTAAGCTCCGGACGCAACAAGTCAACTACCAATAACATCTTGTGCTTGATCAAGTTGGACGCTGTTGCAGGTGGAGCAATATTTGCCAGAAC
GAAGTGCACGAAGTTGGGATACCAGCCACCAGGCCCTCCGAAAATATGACGGCAATGAAATTTAAGTAATTCAATGAAGTCAGTAATTGCAGGGTAGCTC
TGGCATTATCAAATACGTTATTCCACTGGTAAGCGTAATATCACCCCTACCTTGCTCCTCACTTGTTCGAGTTGACCAAATCATCCACAGTCTTGACACT
CCAAAGGTGGCGATTCACCTTGAGAAATAAAATAATATCAATGTTGATCGGAAGCAGTCCTTGACGGTGGCTGCCGAGCACATGCTTTACGTGACTAAAG
AAATGCTCGCACATGTTCGAAGTAGGAAGAATCACAGCAAAATAACGTTTGGCGGTACTGGCCGTAAGTTATTTACATTTTTCGTGCTAACATAAAAATA
TGTTATTCAGTACAAATATTGCAGTACTATTTTCACTTCAATGTATTATTCAGAGGGCCTGCCAGCCACATCTGAACGATCCAAAATCTTCCATGCCGTA
ATCGTTCGCTTCAACAGGATACCGTCCCGTTATCAGGCTTCGCCTCATCCTAGTGTACGATCATCTGGCCCTTTAGAGTGATGCTATGATAGTACAGCAC
CGTATCAATCGGAATTGGAAGCAAGGTTTCTGCTGTACAGTAGCATTGATGTCGCGGCATCGGTGTCTTGTACCATCATGCCACAGTGACTAAGCTCAAA
TCGCCATCTTCAGATCTTTCATCTGTTCGTAGGGAATCAGCACAGTGTGCCTGGCTCACGAACAGTGCAATGCGTTATCTTCTCTTTCGCCGTCTCCAGT
GCATGCTTAAGGAAAAATGGGGATCAATGTCGTGTGGTGCTCGAGAGTGTCCCTCGCAACACGATATGTATATACTGGTAGTCCCTTTCGGTCCTCACTT
CCATTTTCGCACCGTGTTCCTGATTGTCAAAGCCTTTCCAAGACGATGCTTTCCATTCGGTTGCTTGCAACTTCAGCACTGAGCTTCGGCCTCCTGCTTT
CCCAGTCTTTGCAGACCAACGCGGACTACGCCGTGAAGGCTGATGCCGCCACGACACTAGTCAGCTCCTGGGATGGCTGGGGCACGTCGCTCTGTTGGTG
GGCCAATGCATTCGGTGATCGCGAGGACATTGCTGACTTACTCTTCACAACGAAGGACGCTGTGACGTTGAACGCTCAACGTCTAGCCTTCCGGCACTGG
GGCTCTCCATTGCGCGATACAACATCGGTGGATCAGCCAACAACGTCGTCGATGACAGCGGCACTGAGGTTTCCATGGAAACGTCGGACGAAATGCCGGC
TTTTAAGTTCATGGAGGCATTTTGGCTGGACTGGATGAGTAAGGACCcaacgagcacgagctggaactggGAAGCCGACGCGAAACACCGCGCGATGGTC
CGTCTTGCAACGCagcgcgacgtcgacatCTTGGAGGCTTTTTCAAACTCGCCTCCATGGTGGATGACAAACAACCATGCCCCTGCTGGTGGGGACGACG
GAGACAATGACAACTTGGACGATTGGAATCACGACCAGTTTGCGTTGTACTTGGCCACCGTGGTTAGCCACGCCAGGACGAGCTGGGGGATCAATTTCAC
ATACGTTGAAGCCTTCAACGAGCCGATGAGCACGTGGTGGGAGTACCCgggcggccaagaaggctGCCACTTCGAGGTAGATACGCAAATGGATATCCTG
GTAAAGCTTCGCTCACAACTGGACACTCTGGGACTACAGGATGTGGCCATCTCATCCTCCGATGAAAACTCtccgtcgctggcgctgtccacACTCACGT
CCATGTCATCGGATGCTGATGCCATGGCTGCCATCGGCAAGGTGAACACCCACGGCTACGACGGCCAAAGTCCGTACCGCGGAGATGATTGAGCACCCTT
GAAGACACTAGTGAATCAGTCGGAGAAAAAATTCTGGGACTCTGAGTATGGGGAGAGTGACGCGACAGGGCTGAGTCTGGCCGAATCTATCGCGCTCGAC
ATCAATCAGATGGGAGTGTCAGCATTCGTGTACTGGCAAGCGCTAGACAGCGGAGCTTGGGGCCTCATTCAGTCCAACCCGGGTGACAACTGGATCGGCA
CGCCCAACCCGAAGTACTACGCGCTCATTCAGTATTCACGTCACATCCGACCGGGCATGGCGATCCTCTCCACAGACGACGACACGAACACTGTCATGGC
GTTCGACGCCTCGTCaaagctggtggtgctggtaaCGGTGAACGCGGGCGACTCAGCGTCGACGGTCACGTTTGATCTgtcgagcttcacgacggTTGCA
GGTCCCATCacagcgtggacgacggagacgagCGGCACGGGAGCGCTGCATGAGTCTGCGAAGGTCGCTTTGTTGGGAACAACCTTCAGCGTGTCGATCT
CTGCTGCTTCGGTGATGACATTTGAGGTACAGGGAGTTGCCGTGTAGTGTAGTCTCGCGTCATCCTCATAGGCGGTGGGTTTGCTCCCCGCCACCAACCT
GCGTCTGAGCTCCAGGAATCTCGCAGTCAATATTACCGACTTGGTAGCTGCACCCCACGACAGTGGGTCGACCACAAGGGTTAGTCGAGTCCACTCGAAT
CCACAGGATTACCTCTCGAggctcggcgtccaccagaTGCTGTGTTCGGATCGGAGTCAagtcaagttgaagttgctcgTTCACGAGACTTTGTACTCCG
ACTGCCAGTATTCGTGTGGCGTCCGGCAGCCAGACAGAAGAACACTGTGCGCCATCACCCGCAACGCCATTGCcaacgggggggggggcatgcGCTGCGA
ACACACCTCCATTCGGGTTGATCTATGTTGATCTATGCGAGAAATCGACCAATCAAATCAGCCCTCGAAGCCAAGTATGCGCACACAGCCACTTCGAGAA
ACGCCTGGCGACGCAGACGACCTTCTCAACTGCTTGGGGAGACCATGACGAGCACATTGGGGGTCCCGGCGCGGCCCGACCAGCTCACGACCGatttcct
gcagcagatcctgcgcgCTTCGTATccggcgcagcgcgtggtcGACTTCCAGTGGGAGCCCATGAACCTCGGGGTCATCGCGGAGGTGGTGATCATCACG
GTGGAGTTCGAGTCTGAAGACGAGGCCAGGACAATGGAAAAACGCTTTGTGGGGAAGTTCATGCGGCCGGAATTCCCGTTCGAGTCCATGTTCTCGGTGG
AGTCCAAGTTCTACAACGAGTTCTCGACGAAGGCAGGGGATGCAGCCATGAAGAACTCGGCGGCCGTTGTGGGGTTCCCGTTCGCCATCCCGACCGCAAT
CTTCACGTCTAATGTGCTGATTGTGCTGGAGTGCGTGGAGTCGGTGAAGACCTTCACTTGCGTAAATGGGAGCCCGCCCCACCATATCCCGATGCTGGTG
ACGAAGCTTGCGCAAATGCACGCGCGCTTCTGGGATCACGACTGCGACGGGCTCGCAACTCCAGCGGGGATTGGCAGTCAACTTACAGGCGAAGAGAAGT
GTCTGCGGTTCCCAGGCTGCTGGGAGGACTATTTGGATGACGTGTCGTTGGAAagcagcgagaaggccaagttGGCTGCACTGTGCCAACATATGAGCCA
AAAGCCagagcagctcaaggtgatACATGATATGGTGGATAACGGTCCGTCTTCGTTGATCCATGGCGACTTTCACATTGCGAACATGCTCTTGCCGACG
GAtgacacggaggaggaggtgacGTGGCTCCTGGATTGGGCGACGTGCGGAAAGGGCAATCCGCTGCGAGacctcgccttcttctttATCGTCAGCGTCC
AAGCAAGCCACCGCCGAACACAAGAAGCAGGGTGTCTGGAAATGTATCGCAAGGCGCTGACAgcagaagcggaagctgTGTGTCTaccgctggacgagct
gcaccggATGTATAAGGTGTGTGTGCTCAACCAGTTCCTAATCTTGGTTGTCTTCGACAACCTCAGCAAAAGCCTCGCGGCCAATGCAAAGACCGAGAAA
CtccgcgaggagctggacgcgcatTTCCGAGAAGTGAATCGCCGCGCTTGCTTAAGCGTCCTGGACAACTTCAGCGAGAGGGacctccagcttctggaag
CCCGTTGCACGTGACAACCTTGGATGTAACGCTGCGGATCGGCCGTAGCTACTGTAACTTCAATTTGAAGCCATCTCTGGCCTTACATGTATTCTCTCGG
AACCGATTGCTGCGTCGATTAGGTGAGGCAAACCGCAAGATGAAGATCTCGATGCGATGATTACGAGTGGCGTGCTTTGAGCTGGTGATGTCGGTCGGCA
GGCATCGCAGTTGGGCTCTCCAGCCACAGAGCGACTCGCTCAGCCAGCCCCGCAGCGGGAGCTCCATCTTGCCGATGGAAACGTAAGGCCTTGCTTGATG
CGGGATgcactcgtgctgcttgaaggtGTCGCAGAGCTGACTCAACCGCCAATGGGATCAGTTGACGGGTGGCTATGTATTTTGATCTGAGACCTACTGC
GCCCGATTGGATTGTAGCGCTAGCGTAGAATTATTTTACAAAACCATTGCTCCAGTCTgtagctgcagctcgaccagCCTGTCTGCGGGGCACAAAAGAA
AAACGCCAGCGAAGGGAGCGGAGCGTCGACTGCGCACCAACAAGTGCGGACATGGCGCGCTCGATTCCGAAGCCCAACCCGATCCTGGACACCCTGCTGG
TGAGCCTTCTCGTGTGTGAGCTGGGGGTTATCACACACACGCTGTGGGACGACAAGCAGATGCTCTACATCCTCCTCGCTATGGtcttcgtggtggcgct
ggcagtCAAGCTGACCAAGACCTCGTTCGCCATCGGAGGCGGGTGGTTCTCGCGCacgttcctgcagcacctcggtgacccgctcaagaaggcggtgaCC
ATGAAGAAGTGGTGCGACCAGTCGTGGCAGCTCGCCGTACACGTGTCCATGACGATCTTCGAGCtgtacgtgctgcgcgaTGAGACGTGGTGGCAGGACA
CGGCAACCCGTAAGGACCTTGTTTGACTGGAGGAAGTGCAGGGAGGGACCAAGAGATCTGACTGACCGGATGGCACTTCCGTCTATGATACACTGCAGTG
TGGAACCAGGGAACGGACACGGGCGTGTTCCCGACACAGAAGTTCAGCACTAAGCTGCTTTACATCACACAACTGGTGAGACCCGTGGCATGAGCCTCGT
TTGCGGGCGGAGTGTCGAAAGACGGCTAACTTATGCTATTTTTTGTTGTCATTGACTCCTCCTCCTTATTAGGCCATTTGGATCTACACCGCATTCTCGT
GTAAGTTCCTGGAGGAGATCCGCAAGGACTACTTGGTGATGATGACGCACCACGTCGTCACAATTGCGCTGGTCACGTGGTCATACGCGGTTGGTTTCTT
GCCCGTGGGTGTGGTCGTGTTGCTTCTGCACGATATGACTGATATCCCGCTCGacatgctgaagatggcAAACTACCTCAAGATGGAAGGCGTTCCGGGT
CTATTCACGAGCGAGATCCTGTTCGTTACCACGATCGTGCTGTGGTTCTACTACCGCATCTACCAGTACCCGACCAAGCTGCTCTATACGACCGTGGTGG
AGAACCGCGAGGCCAGCATGACAATGGCGGACGCGCACGACTTCACGCAGCTGTTCCCGTACCCAGGCCCTCCGTCGTGGCTGCTCTTCAAtgtgctgct
cacgacgcTGTACTGCCTGCACATTTGGTGGGgtctcctgctcgtgcggGTACTCGTTGGCGTGGTAACCAAGGGCGCCCACGATACAGCCAAGGAGGAA
TACGAAGGCACgtcgtccgactcggacaACGAAAACAAGGACGACTAGAAGGTAAACGCGCTTGTGCATGAAAACACTGGACTAGagggaggaggaggaa
ggcaGCAACTTGATCAGGAGAGTAAGTGAGAGACAATGAAAGAAAGTGTGCAGGCGGTAAGGCGGCTTTATCTAACCTGCCCAATCTGCTATCGAATTAA
AGAGGTTGTTTTTGGCGCGTTCATTTTGACAACCAGTTCGTGGGATAAACGGCAGCCAGCATGATGGAAGCGTTGGGCGAGGCGCCACCAGCGTTTGTGG
AGTCGCTGGTCACGGAGGACGCTATTGTGAAGGCGCTGCGGAAGATGCTTCCACTGATGAACGCAGACACGGTGACGCTGAAGGTAGTGATGCAGAAGCT
TGCGGTGCGCTTCGGCATGGAGTTCGGGGGCTTCAAAGCGCAGTGGAAGTCTCGAATTAAGGCACTGCTGCCGGATATGCTCGAGTTGTGTCCAGGTGGA
GATGCTTCTGAAAATGAGAGCGAACATGCCGAGGCTGATGCTCCagaaggagacgacgaagaagaagaagaagaggtTGATCTACGCCCCATCAGGAAGC
GCACGGCGCGCGCCGTTAAAAAGCGCAACGCAGTGGTGGATGcgagtgaagaagaagatgatgatgcCAATGACAGCGATGCAAGCGAAGGCGAGGCAGC
TAAGCTtgaggaagatgaagacgatgttgCTCCAGCGAAGAAGAGACGCACAGCGGTATGGACGTTGCTTTAGCTGCTATTACGAGCTGTTGCAGTGTTG
CGTTGCGCTTGTGCTGATGGTGActtttttgttgttgctttATGGCTCATGACTGCAGTCGGACAAGAGCCACACCAACAAGCGAAAGAGCAAGGAATCC
GCGCCACTGGCAAAAAAGCCCAAGATGGTCAAGCAGGTGGACCCGCCGGGACTTGCCTCGTTGAAGGAACTGGGCCGCGCGGCTGGTGTCCTCAAGTACG
TATTGAGATTGAAACAAGCGTATTATTGTGCACTAACCGTGCTGGGTGCTTTATTTATCCTGTACACATTTCAGTCCACGGGTGTACAAGCTCCTGAAGG
GTGCTGATTCGACCGAGGAAGCGGAAGAGATCCTGCGTGATCGATTGCAGGATGCCGGTGTTGCTTTTCACGGTTCGTATCCTACGAGCCGCGACGTCAG
CGCTACGAAGAGGAAGCacgcgaaggagaaggaacTGGAGGGCATTGACTCAAGCTTGATCATCACGGGTGGTCGATCGCGCCGTGGAGGAGGGGAGCAC
ATTTCGTACAAGCACGAGCGCCTCAGTGGCGAGGAAGATAACGCCGAAGTGGAAGAGGACGACaaggaagacgccgacgaggtggaggaggaggaggagg
aagaggagtctgccgccagcgactcggactcgtcggAGGCGTCATTTTAAACTTGCATAACTGGCGGCGATATGTATGTGAGGTAGCAGCTTGCCCAACC
GCTAATAGAGAAATGTTGCTACCGAAACGTGCCTCAAGCTGGCTTCGTAGCagtgcaagttgcagtgcCTCATGCTGGTTTCAGATGCCCTTTAGAAATG
CATTGCTAAAAGCGCGCCGCCCGTTAGAAACGCATACCCTGTTATCCGGCGCCGGATAAGCTATCTTGTCGACTAACGCGCGGATTGGCCAAAATGCGTC
GATTTTCAGTCGGCCGGGTGATTGGTGGTGGGGGCGCGTGGCCTGCCTTGGTCTCGGGGGCCGACGGCATTTGCCGCTCACCAGTTTCCAGAACCCGAAC
GTGAAGCAAGAATCATGCCGTCCTACAGCCAGGAACCTGAAGACGCTCAGCGCGCCGCCAAGGCCCGCGGCTCGCACCTCCGCGTGCACTTTAAGCACTG
CCGCGAGGTCAGCCACGCCATCAAGGGCATGCCCCTGAACAAGGCGAAGAGCTTCCTGCAGGCCGTGACCGAGTACAAGCAGGCTGTGCCCTTCACCAAG
TTCACGGGCGGCTGCGGCCGTCACGCTCAGGGTAAGCTCCGCGGTGCCGCTGGCGACAAGTGCAAGTGGCCCCAGAAAGCCACCAAGATCATCCTGGACC
TGGTGAAGAACGCCGAGGCCAACGCCGAGGTCAAGGGCCTGGACACGGACCTGCTGTACATCTCGCACGCTCAGGCCAACGCCGCCATTAagcagcgccg
tcgcacCTACCGCGCTCACGGCCGCATCGGACCCTACATGTCCAACCCGGCCCACATCGAGCTGATCCTGACGGAGAAGCGCGCTAACGTTgccaaggcc
gtggaggaggccaaggccgtCAAGGTGTCCCGCAAGCGTCAGGCCCAGCTGCGCCTTAAGtctggcggcggcgtcccGGCCAACTAAGTTGTTTTCTGTG
CACGGGATATCTCTTGCCTGAAACACGAACGGTCAGTCGGGAACGAGCGACTGTAGACGCGAGGGGGGTGGCGAAAAGTTTGGTAAAACTTTTTAATACA
GCCTTGCCGAGAAATGGGTTCTACTGATGCAGTGTCTGTTGCCACGTGAGCAAGCGCGTTTTCCAGTTCGTCTTCCGTGGTGTTTGGGGGTGTCCTCGCG
AGGTCGTTGTGGTTTGCCTTGGTGCATACAGATGCAGGTTCGGCAGCTGCGGGACGGATGTAGGGTCGTCAGGTTCGAACGAAGCGTGGCGTGGAGGATG
ACAGCGGTGAGCTGTGGTTTTGCATGGCGGACTGGACAAGCTAGGATGGAGGCGCGGTGGGCAGTTCTCTGATGGTGATCAAGTCACTGACAATGGACCG
GCTGTTTGTAGCGTTGAAGACCGAAGACAGCAAGTCGATCCAAGCTTGCAATCGATGCCGCGAAGGGAAGTAAACTACCCACACCTGCAGCGTGCTCGGG
TCCTGGATAGTCATCCACCACTTGGACGCACCGTGTGCGTCAGTCTCCTCTACGGACGTGACAAGACTGATGTTGTGGAGACGCATCAcgtgcttgaagc
tgccgtagtgcaggaggtgctgcgcttGGTCGAGGTGTAGGTGCTgcttccgctgctgcattttcGGCACGAAGAAGCCTACGGGCTCTTCGATGTAGAC
CCACTCGCTTCCTGTGGCTGCGCAGTCGTCTTCACTAAATGCGCTGTCCTCCTCGCACGTGTCCGTGTCGTGCTgtgtcgtcttcttctttgacGGGCAC
AGGGACGGGAAGCGCCACCAAATTGCTCCGGCGCCGAGCATTGCTCACGCACACAATTCAGCTGCTTCGAGAAGACGTTGTTATACTGAGTGCATCTTGC
CAAATACAGCTCCCAACGCCACTTTACGTGTTGCTCCTCAAAAATGCTTTCGTTGAGCGCGATAAGACCTGACACAAGATATTGGTCATTTACGATACCC
CGGAAATAGACGTGGAATTGGTGGACCACCAATGGGTGGTGTCAGCTTACCTCCTTCGTCTGCTTCGGTTTGGAGTTCAGGAGCATGGACTTCATTTCTT
CTTTACGAGCGAATCCACCTTCGTGATAGCGCACAAGACGCAACGAGCAAAAGCTGCACACTGTGGGTCATTGGGAGAAGA